SPON2-spondin 2, extracellular matrix protein Gene View larger

SPON2-spondin 2, extracellular matrix protein Gene

PTXBC002707

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPON2-spondin 2, extracellular matrix protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPON2-spondin 2, extracellular matrix protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002707
Product type: DNA & cDNA
Ncbi symbol: SPON2
Origin species: Human
Product name: SPON2-spondin 2, extracellular matrix protein Gene
Size: 2ug
Accessions: BC002707
Gene id: 10417
Gene description: spondin 2, extracellular matrix protein
Synonyms: DIL-1; DIL1; M-SPONDIN; MINDIN; spondin-2; differentially expressed in cancerous and non-cancerous lung cells 1; spondin 2, extracellular matrix protein; spondin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaaaccccagcccggccgccgccctgggcaaggccctctgcgctctcctcctggccactctcggcgccgccggccagcctcttgggggagagtccatctgttccgccagagccccggccaaatacagcatcaccttcacgggcaagtggagccagacggccttccccaagcagtaccccctgttccgcccccctgcgcagtggtcttcgctgctgggggccgcgcatagctccgactacagcatgtggaggaagaaccagtacgtcagtaacgggctgcgcgactttgcggagcgcggcgaggcctgggcgctgatgaaggagatcgaggcggcgggggaggcgctgcagagcgtgcacgaggtgttttcggcgcccgccgtccccagcggcaccgggcagacgtcggcggagctggaggtgcagcgcaggcactcgctggtctcgtttgtggtgcgcatcgtgcccagccccgactggttcgtgggcgtggacagcctggacctgtgcgacggggaccgttggcgggaacaggcggcgctggacctgtacccctacgacgccgggacggacagcggcttcaccttctcctcccccaacttcgccaccatcccgcaggacacggtgaccgagataacgtcctcctctcccagccacccggccaactccttctactacccgcggctgaaggccctgcctcccatcgccagggtgacactgctgcggctgcgacagagccccagggccttcatccctcccgccccagtcctgcccagcagggacaatgagattgtagacagcgcctcagttccagaaacgccgctggactgcgaggtctccctgtggtcgtcctggggactgtgcggaggccactgtgggaggctcgggaccaagagcaggactcgctacgtccgggtccagcccgccaacaacgggagcccctgccccgagctcgaagaagaggctgagtgcgtccctgataactgcgtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - IQ motif and ubiquitin domain containing
- RNA terminal phosphate cyclase domain 1
- UDP-glucose ceramide glucosyltransferase
- pyruvate dehydrogenase kinase, isozyme 4

Buy SPON2-spondin 2, extracellular matrix protein Gene now

Add to cart