Login to display prices
Login to display prices
U2AF1-U2 small nuclear RNA auxiliary factor 1 Gene View larger

U2AF1-U2 small nuclear RNA auxiliary factor 1 Gene

PTXBC001177

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of U2AF1-U2 small nuclear RNA auxiliary factor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about U2AF1-U2 small nuclear RNA auxiliary factor 1 Gene

Proteogenix catalog: PTXBC001177
Ncbi symbol: U2AF1
Product name: U2AF1-U2 small nuclear RNA auxiliary factor 1 Gene
Size: 2ug
Accessions: BC001177
Gene id: 7307
Gene description: U2 small nuclear RNA auxiliary factor 1
Synonyms: FP793; RNU2AF1; U2AF35; U2AFBP; splicing factor U2AF 35 kDa subunit; U2 small nuclear RNA auxillary factor 1; U2 small nuclear ribonucleoprotein auxillary factor, 35-KD subunit; U2 snRNP auxiliary factor small subunit; U2(RNU2) small nuclear RNA auxiliary factor binding protein; splicing factor U2AF 35kDa subunit; U2 small nuclear RNA auxiliary factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagtatctggcctccatcttcggcaccgagaaagacaaagtcaactgttcattttatttcaaaattggagcatgtcgtcatggagacaggtgctctcggttgcacaataaaccgacgtttagccagaccattgccctcttgaacatttaccgtaaccctcaaaactcttcccagtctgctgacggtttgcgctgtgccgtgagcgatgtggagatgcaggaacactatgatgagttttttgaggaggtttttacagaaatggaggagaagtatggggaagtagaggagatgaacgtctgtgacaacctgggagaccacctggtggggaacgtgtacgtcaagtttcgccgtgaggaagatgcggaaaaggctgtgattgacttgaataaccgttggtttaatggacagccgatccacgccgagctgtcacccgtgacggacttcagagaagcctgctgccgtcagtatgagatgggagaatgcacacgaggcggcttctgcaacttcatgcatttgaagcccatttccagagagctgcggcgggagctgtatggccgccgtcgcaagaagcatagatcaagatcccgatcccgggagcgtcgttctcggtctagagaccgtggtcgtggcggtggcggtggcggtggtggaggtggcggcggacgggagcgtgacaggaggcggtcgagagatcgtgaaagatctgggcgattctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: