U2AF1-U2 small nuclear RNA auxiliary factor 1 Gene View larger

U2AF1-U2 small nuclear RNA auxiliary factor 1 Gene

PTXBC001177

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of U2AF1-U2 small nuclear RNA auxiliary factor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about U2AF1-U2 small nuclear RNA auxiliary factor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001177
Product type: DNA & cDNA
Ncbi symbol: U2AF1
Origin species: Human
Product name: U2AF1-U2 small nuclear RNA auxiliary factor 1 Gene
Size: 2ug
Accessions: BC001177
Gene id: 7307
Gene description: U2 small nuclear RNA auxiliary factor 1
Synonyms: FP793; RNU2AF1; U2AF35; U2AFBP; splicing factor U2AF 35 kDa subunit; U2 small nuclear RNA auxillary factor 1; U2 small nuclear ribonucleoprotein auxillary factor, 35-KD subunit; U2 snRNP auxiliary factor small subunit; U2(RNU2) small nuclear RNA auxiliary factor binding protein; splicing factor U2AF 35kDa subunit; U2 small nuclear RNA auxiliary factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagtatctggcctccatcttcggcaccgagaaagacaaagtcaactgttcattttatttcaaaattggagcatgtcgtcatggagacaggtgctctcggttgcacaataaaccgacgtttagccagaccattgccctcttgaacatttaccgtaaccctcaaaactcttcccagtctgctgacggtttgcgctgtgccgtgagcgatgtggagatgcaggaacactatgatgagttttttgaggaggtttttacagaaatggaggagaagtatggggaagtagaggagatgaacgtctgtgacaacctgggagaccacctggtggggaacgtgtacgtcaagtttcgccgtgaggaagatgcggaaaaggctgtgattgacttgaataaccgttggtttaatggacagccgatccacgccgagctgtcacccgtgacggacttcagagaagcctgctgccgtcagtatgagatgggagaatgcacacgaggcggcttctgcaacttcatgcatttgaagcccatttccagagagctgcggcgggagctgtatggccgccgtcgcaagaagcatagatcaagatcccgatcccgggagcgtcgttctcggtctagagaccgtggtcgtggcggtggcggtggcggtggtggaggtggcggcggacgggagcgtgacaggaggcggtcgagagatcgtgaaagatctgggcgattctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane and coiled-coil domains 6
- hippocampus abundant transcript-like 1
- spondin 2, extracellular matrix protein
- IQ motif and ubiquitin domain containing

Buy U2AF1-U2 small nuclear RNA auxiliary factor 1 Gene now

Add to cart