Login to display prices
Login to display prices
ASB6-ankyrin repeat and SOCS box-containing 6 Gene View larger

ASB6-ankyrin repeat and SOCS box-containing 6 Gene

PTXBC001719

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ASB6-ankyrin repeat and SOCS box-containing 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ASB6-ankyrin repeat and SOCS box-containing 6 Gene

Proteogenix catalog: PTXBC001719
Ncbi symbol: ASB6
Product name: ASB6-ankyrin repeat and SOCS box-containing 6 Gene
Size: 2ug
Accessions: BC001719
Gene id: 140459
Gene description: ankyrin repeat and SOCS box-containing 6
Synonyms: ankyrin repeat and SOCS box protein 6; ankyrin repeat and SOCS box containing 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgttcctgcacggcttccggaggatcatcttcgagtaccagccgctggtggatgcgattctgggctccctggggatccaggaccccgagcggcaggagtctctggaccggcccagttatgtcgccagcgaggagagccgaatccttgttctcactgagctgctggagaggaaagcccactctcccttttaccaggaaggcgtcagcaacgccctgctcaagatggctgagctggggctgacgcgggcggccgacgttctcttgcggcatggggccaatctcaactttgaagacccagtcacctactacacggccttgcacatcgccgtcctgcggaaccagccggacatggtggagctgctggtgcatcacggggccgacgttaatcggagggaccgggaaaaactgctctgctccatgctctggccagcagcgacggggtgcagatccacaatactgagaacattcgtctcttactggaaggaggggcagacgtcaaggccaccaccaaagatggggacacagtgttcacctgcatcatcttcctgcttggtgagaccgtgggaggggacaaagaggaggcccagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: