NDUFB5-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa Gene View larger

NDUFB5-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa Gene

PTXBC009796

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFB5-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFB5-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009796
Product type: DNA & cDNA
Ncbi symbol: NDUFB5
Origin species: Human
Product name: NDUFB5-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa Gene
Size: 2ug
Accessions: BC009796
Gene id: 4711
Gene description: NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
Synonyms: CISGDH; SGDH; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 5, mitochondrial; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa; NADH-ubiquinone oxidoreductase SGDH subunit; complex I SGDH subunit; complex I-SGDH; NADH:ubiquinone oxidoreductase subunit B5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccatgagtttgttgcggcgggtttcggttactgcggtggcagctctgtctggccggccccttggcactcgcctcggatttgggggcttcctcactcgtggctttccgaaggctgctgctcctgttcgacacagtggagaccatgggaaaagactatttgtcatcagaccttctagattctatgacaggcgttttttgaagttattgagattctacattgcattgactgggattccagtagcaattttcataactctggtgaatgtattcattggtcaagctgaactagcagaaattccagaaggctatgtcccagaacactgggaatattataagcatcccatatcaagatggattgcccgtaatttctatgatagtcctgaaaagatatatgaaagaacaatggccgtccttcagattgaagctgaaaaggctgaattacgggtaaaggagctggaagtgcgaaaattgatgcatgtgagaggagatggaccctggtattactatgagacaattgacaaggaacttattgatcattctccgaaagcaactcctgacaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SEC22 vesicle trafficking protein homolog B (S. cerevisiae)
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
- serpin peptidase inhibitor, clade B (ovalbumin), member 6

Buy NDUFB5-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa Gene now

Add to cart