TMCO1-transmembrane and coiled-coil domains 1 Gene View larger

TMCO1-transmembrane and coiled-coil domains 1 Gene

PTXBC000104

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMCO1-transmembrane and coiled-coil domains 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMCO1-transmembrane and coiled-coil domains 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000104
Product type: DNA & cDNA
Ncbi symbol: TMCO1
Origin species: Human
Product name: TMCO1-transmembrane and coiled-coil domains 1 Gene
Size: 2ug
Accessions: BC000104
Gene id: 54499
Gene description: transmembrane and coiled-coil domains 1
Synonyms: HP10122; PCIA3; PNAS-136; TMCC4; calcium load-activated calcium channel; CLAC channel; transmembrane and coiled-coil domain-containing protein 1; transmembrane and coiled-coil domains 4; xenogeneic cross-immune protein PCIA3; transmembrane and coiled-coil domains 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcactatgttcgcggacactctcctcatcgtttttatctctgtgtgcacggctctgctcgcagagggcataacctgggtcctggtttacaggacagacaagtacaagagactgaaggcagaagtggaaaaacagagtaaaaaattggaaaagaagaaggaaacaataacagagtcagctggtcgacaacagaaaaagaaaatagagagacaagaagagaaactgaagaataacaacagagatctatcaatggttcgaatgaaatccatgtttgctattggcttttgttttactgccctaatgggaatgttcaattccatatttgatggtagagtggtggcaaagcttccttttacccctctttcttacatccaaggactgtctcatcgaaatctgctgggagatgacaccacagactgttccttcattttcctgtatattctctgtactatgtcgattcgacagaacattcagaagattctcggccttgccccttcacgagccgccaccaagcaggcaggtggatttcttggcccaccacctccttctgggaagttctcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prostaglandin D2 synthase 21kDa (brain)
- ankyrin repeat and SOCS box-containing 6
- glutamate decarboxylase 1 (brain, 67kDa)
- U2 small nuclear RNA auxiliary factor 1

Buy TMCO1-transmembrane and coiled-coil domains 1 Gene now

Add to cart