SSX2-synovial sarcoma, X breakpoint 2 Gene View larger

SSX2-synovial sarcoma, X breakpoint 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SSX2-synovial sarcoma, X breakpoint 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SSX2-synovial sarcoma, X breakpoint 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007343
Product type: DNA & cDNA
Ncbi symbol: SSX2
Origin species: Human
Product name: SSX2-synovial sarcoma, X breakpoint 2 Gene
Size: 2ug
Accessions: BC007343
Gene id: 6757
Gene description: synovial sarcoma, X breakpoint 2
Synonyms: protein SSX2; CT5.2; CT5.2A; HD21; HOM-MEL-40; SSX; cancer/testis antigen 5.2; cancer/testis antigen family 5, member 2a; sarcoma, synovial, X-chromosome-related 2; synovial sarcoma, X breakpoint 2; synovial sarcoma, X breakpoint 2B; tumor antigen HOM-MEL-40; SSX family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacggagacgacgcctttgcaaggagacccacggttggtgctcaaataccagagaagatccaaaaggccttcgatgatattgccaaatacttctctaaggaagagtgggaaaagatgaaagcctcagagaaaatcttctatgtgtatatgaagagaaagtatgaggctatgactaaactaggtttcaaggccaccctcccacctttcatgtgtaataaacgggccgaagacttccaggggaatgatttggataatgaccctaaccgtgggaatcaggttgaacgtcctcagatgactttcggcaggctccagggaatctccccgaagatcatgcccaagaagccagcagaggaaggaaatgattcggaggaagtgccagaagcatctggcccacaaaatgatgggaaagagctgtgccccccgggaaaaccaactacctctgagaagattcacgagagatctggacccaaaaggggggaacatgcctggacccacagactgcctgagagaaaacagctggtgatttatgaagagatcagcgaccctgaggaagatgacgagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADP-ribosylation factor-like 4A
- ADP-ribosylation factor-like 4D
- chromatin modifying protein 2A
- mixed lineage kinase domain-like

Buy SSX2-synovial sarcoma, X breakpoint 2 Gene now

Add to cart