Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SSX2-synovial sarcoma, X breakpoint 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SSX2-synovial sarcoma, X breakpoint 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007343 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SSX2 |
| Origin species: | Human |
| Product name: | SSX2-synovial sarcoma, X breakpoint 2 Gene |
| Size: | 2ug |
| Accessions: | BC007343 |
| Gene id: | 6757 |
| Gene description: | synovial sarcoma, X breakpoint 2 |
| Synonyms: | protein SSX2; CT5.2; CT5.2A; HD21; HOM-MEL-40; SSX; cancer/testis antigen 5.2; cancer/testis antigen family 5, member 2a; sarcoma, synovial, X-chromosome-related 2; synovial sarcoma, X breakpoint 2; synovial sarcoma, X breakpoint 2B; tumor antigen HOM-MEL-40; SSX family member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacggagacgacgcctttgcaaggagacccacggttggtgctcaaataccagagaagatccaaaaggccttcgatgatattgccaaatacttctctaaggaagagtgggaaaagatgaaagcctcagagaaaatcttctatgtgtatatgaagagaaagtatgaggctatgactaaactaggtttcaaggccaccctcccacctttcatgtgtaataaacgggccgaagacttccaggggaatgatttggataatgaccctaaccgtgggaatcaggttgaacgtcctcagatgactttcggcaggctccagggaatctccccgaagatcatgcccaagaagccagcagaggaaggaaatgattcggaggaagtgccagaagcatctggcccacaaaatgatgggaaagagctgtgccccccgggaaaaccaactacctctgagaagattcacgagagatctggacccaaaaggggggaacatgcctggacccacagactgcctgagagaaaacagctggtgatttatgaagagatcagcgaccctgaggaagatgacgagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ADP-ribosylation factor-like 4A - ADP-ribosylation factor-like 4D - chromatin modifying protein 2A - mixed lineage kinase domain-like |