CHMP2A-chromatin modifying protein 2A Gene View larger

CHMP2A-chromatin modifying protein 2A Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHMP2A-chromatin modifying protein 2A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHMP2A-chromatin modifying protein 2A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002502
Product type: DNA & cDNA
Ncbi symbol: CHMP2A
Origin species: Human
Product name: CHMP2A-chromatin modifying protein 2A Gene
Size: 2ug
Accessions: BC002502
Gene id: 27243
Gene description: chromatin modifying protein 2A
Synonyms: BC-2; BC2; CHMP2; VPS2; VPS2A; charged multivesicular body protein 2a; VPS2 homolog A; chromatin modifying protein 2A; vacuolar protein sorting-associated protein 2-1; vps2-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacctattgttcgggcgccggaagacgccagaggagctactgcggcagaaccagagggccctgaaccgtgccatgcgggagctggaccgcgagcgacagaaactagagacccaggagaagaaaatcattgcagacattaagaagatggccaagcaaggccagatggatgctgttcgcatcatggcaaaagacttggtgcgcacccggcgctatgtgcgcaagtttgtattgatgcgggccaacatccaggctgtgtccctcaagatccagacactcaagtccaacaactcgatggcacaagccatgaagggtgtcaccaaggccatgggcaccatgaacagacagctgaagttgccccagatccagaagatcatgatggagtttgagcggcaggcagagatcatggatatgaaggaggagatgatgaatgatgccattgatgatgccatgggtgatgaggaagatgaagaggagagtgatgctgtggtgtcccaggttctggatgagctgggacttagcctaacagatgagctgtcgaacctcccctcaactgggggctcgcttagtgtggctgctggtgggaaaaaagcagaggccgcagcctcagccctagctgatgctgatgcagacctggaggaacggcttaagaacctgcggagggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mixed lineage kinase domain-like
- asteroid homolog 1 (Drosophila)
- plasticity related gene 3
- ADP-ribosylation factor-like 17

Buy CHMP2A-chromatin modifying protein 2A Gene now

Add to cart