RP11-35N6.1-plasticity related gene 3 Gene View larger

RP11-35N6.1-plasticity related gene 3 Gene

PTXBC022465

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RP11-35N6.1-plasticity related gene 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RP11-35N6.1-plasticity related gene 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022465
Product type: DNA & cDNA
Ncbi symbol: RP11-35N6.1
Origin species: Human
Product name: RP11-35N6.1-plasticity related gene 3 Gene
Size: 2ug
Accessions: BC022465
Gene id: 54886
Gene description: plasticity related gene 3
Synonyms: LPPR1; PRG-3; phospholipid phosphatase-related protein type 1; lipid phosphate phosphatase-related protein type 1; plasticity related gene 3; plasticity-related gene 3 protein; phospholipid phosphatase related 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgtaggaaacaacactcaacgaagttattccatcatcccgtgttttatatttgttgagcttgtcatcatggctgggacagtgctgcttgcctactacttcgaatgcactgacacttttcaggtgcatatccaaggattcttctgtcaggacggagacttaatgaagccttacccagggacagaggaagaaagcttcatcacccctctggtgctctattgtgtgctggctgccaccccaactgctattatttttattggtgagatatccatgtatttcataaaatcaacaagagaatccctgattgctcaggagaaaacaattctgaccggagaatgctgttacctgaaccccttacttcgaaggatcataagattcacaggggtgtttgcatttggactttttgctactgacatttttgtaaacgccggacaagtggtcactgggcacttaacgccatacttcctgactgtgtgcaagccaaactacaccagtgcagactgccaagcgcaccaccagtttataaacaatgggaacatttgtactggggacctggaagtgatagaaaaggctcggagatcctttccctccaaacacgctgctctgagcatttactccgccttatatgccacgatgtatattacaagcacaatcaagacgaagagcagtcgactggccaagccggtgctgtgcctcggaactctctgcacagccttcctgacaggcctcaaccgggtctctgagtatcggaaccactgctcggacgtgattgctggtttcatcctgggcactgcagtggccctgtttctgggaatgtgtgtggttcataactttaaaggaacgcaaggatctccttccaaacccaagcctgaggatccccgtggagtacccctaatggctttcccaaggatagaaagccctctggaaaccttaagtgcacagaatcactctgcgtccatgaccgaagttacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADP-ribosylation factor-like 17
- melanoma antigen family B, 18
- angiotensin II receptor, type 1
- GDP-mannose pyrophosphorylase B

Buy RP11-35N6.1-plasticity related gene 3 Gene now

Add to cart