Login to display prices
Login to display prices
GMPPB-GDP-mannose pyrophosphorylase B Gene View larger

GMPPB-GDP-mannose pyrophosphorylase B Gene

PTXBC001141

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GMPPB-GDP-mannose pyrophosphorylase B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GMPPB-GDP-mannose pyrophosphorylase B Gene

Proteogenix catalog: PTXBC001141
Ncbi symbol: GMPPB
Product name: GMPPB-GDP-mannose pyrophosphorylase B Gene
Size: 2ug
Accessions: BC001141
Gene id: 29925
Gene description: GDP-mannose pyrophosphorylase B
Synonyms: MDDGA14; MDDGB14; MDDGC14; mannose-1-phosphate guanyltransferase beta; GTP-mannose-1-phosphate guanylyltransferase beta; GDP-mannose pyrophosphorylase B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggcactgatcttagtggggggctatgggacgcggctacggccgctgacgctgagcaccccgaagccactggtggacttctgcaataagcccatcttgctgcaccaagtggaggcgctagccgcggcaggcgtggaccacgtgatcctggccgtgagctacatgtcgcaggtgctggagaaggaaatgaaggcacaggagcagaggctgggaatccgaatctccatgtcccatgaagaggagcctttggggacagctgggcccctggcgctggcccgtgacctactctctgagactgcagaccctttcttcgtcctcaacagtgacgtgatctgcgatttccccttccaagccatggtgcagttccaccggcaccatggccaggagggctccatcctggtgaccaaggtggaggaaccctccaagtacggtgtggtggtgtgtgaggctgacacaggccgcattcaccggttcgtggagaagccacaggtgtttgtgtccaataagatcaacgcaggcatgtacatcctgagccctgcagtgctgcggcgcatccagctgcagcctacgtccattgagaaggaggtcttccccattatggccaaggaggggcagctatatgccatggagttacagggcttctggatggacattgggcagcccaaggacttcctcactggcatgtgcctcttcctgcagtcactgaggcagaagcagcctgagcggctgtgctcaggccctggcattgtgggcaacgtgctggtggacccaagtgcccgcatcggccagaactgcagcattggccccaatgtgagcctgggacctggcgtggtggtcgaagatggtgtgtgtatccggcggtgcacggtgctgcgggatgcccggatccgttcccattcctggcttgagtcctgcattgtgggctggcgctgccgcgtgggtcagtgggtacgcatggagaacgtgacagtgctgggtgaggacgtcatagttaatgatgagctctacctcaacggagccagcgtgctgccccacaagtctattggcgagtcagtgccagagcctcgtatcatcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice