GMPPB-GDP-mannose pyrophosphorylase B Gene View larger

GMPPB-GDP-mannose pyrophosphorylase B Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GMPPB-GDP-mannose pyrophosphorylase B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GMPPB-GDP-mannose pyrophosphorylase B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001141
Product type: DNA & cDNA
Ncbi symbol: GMPPB
Origin species: Human
Product name: GMPPB-GDP-mannose pyrophosphorylase B Gene
Size: 2ug
Accessions: BC001141
Gene id: 29925
Gene description: GDP-mannose pyrophosphorylase B
Synonyms: MDDGA14; MDDGB14; MDDGC14; mannose-1-phosphate guanyltransferase beta; GTP-mannose-1-phosphate guanylyltransferase beta; GDP-mannose pyrophosphorylase B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggcactgatcttagtggggggctatgggacgcggctacggccgctgacgctgagcaccccgaagccactggtggacttctgcaataagcccatcttgctgcaccaagtggaggcgctagccgcggcaggcgtggaccacgtgatcctggccgtgagctacatgtcgcaggtgctggagaaggaaatgaaggcacaggagcagaggctgggaatccgaatctccatgtcccatgaagaggagcctttggggacagctgggcccctggcgctggcccgtgacctactctctgagactgcagaccctttcttcgtcctcaacagtgacgtgatctgcgatttccccttccaagccatggtgcagttccaccggcaccatggccaggagggctccatcctggtgaccaaggtggaggaaccctccaagtacggtgtggtggtgtgtgaggctgacacaggccgcattcaccggttcgtggagaagccacaggtgtttgtgtccaataagatcaacgcaggcatgtacatcctgagccctgcagtgctgcggcgcatccagctgcagcctacgtccattgagaaggaggtcttccccattatggccaaggaggggcagctatatgccatggagttacagggcttctggatggacattgggcagcccaaggacttcctcactggcatgtgcctcttcctgcagtcactgaggcagaagcagcctgagcggctgtgctcaggccctggcattgtgggcaacgtgctggtggacccaagtgcccgcatcggccagaactgcagcattggccccaatgtgagcctgggacctggcgtggtggtcgaagatggtgtgtgtatccggcggtgcacggtgctgcgggatgcccggatccgttcccattcctggcttgagtcctgcattgtgggctggcgctgccgcgtgggtcagtgggtacgcatggagaacgtgacagtgctgggtgaggacgtcatagttaatgatgagctctacctcaacggagccagcgtgctgccccacaagtctattggcgagtcagtgccagagcctcgtatcatcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - spermatogenesis associated 17
- spermatogenesis associated 22
- LIM and cysteine-rich domains 1
- ubiquitin specific peptidase 12

Buy GMPPB-GDP-mannose pyrophosphorylase B Gene now

Add to cart