SPATA17-spermatogenesis associated 17 Gene View larger

SPATA17-spermatogenesis associated 17 Gene

PTXBC014608

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPATA17-spermatogenesis associated 17 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPATA17-spermatogenesis associated 17 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014608
Product type: DNA & cDNA
Ncbi symbol: SPATA17
Origin species: Human
Product name: SPATA17-spermatogenesis associated 17 Gene
Size: 2ug
Accessions: BC014608
Gene id: 128153
Gene description: spermatogenesis associated 17
Synonyms: IQCH; MSRG-11; MSRG11; spermatogenesis-associated protein 17; IQ motif containing H; spermatogenesis-related protein 11; spermatogenesis associated 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccacgttagcccggctgcaagctaggtcgtcgactgtaggaaatcagtactactttaggaacagtgttgtagatccatttagaaaaaaggagaatgatgcagcagttaaaatccaaagctggtttcgaggatgtcaagttcgggcatatatcaggcatttaaacaggattgtaacaattattcaaaaatggtggagaagtttcttaggcagaaagcaatatcaactaactgtgcaggtagcatattatactatgatgatgaatctctacaatgcaatggctgtcaggattcagagacgatggcgaggctatagggttcggaagtacctctttaattattattatttgaaagagtacctgaaagtcgtttcagagaccaatgatgcaattaggaaggcactggaggagtttgcagaaatgaaagaaagagaagagaagaaggctaacctcgaaagggaagagaagaaaagagattaccaagcccgaaagatgcattacctcctcagcacaaagcagattccaggaatatacaattcacccttcagaaaagagcctgatccatgggagctgcaattacaaaaggcaaagcctttaacacaccgaagacctaaagttaagcagaaggactccaccagccttactgattggctagcttgtacaagcgcccgttcttttcctcggtctgaaattctaccacctattaatagaaagcaatgtcaggggcccttccgagatatcaccgaagtattagaacaacgctacaggcctttggagccaacgttgcgggtggcagaaccaatcgatgagttaaagttggccagagaggagctcagaagagaggaatggctgcaaaatgtaaatgacaatatgtttttgccattttcttcataccataaaaatgaaaagtacatcccatcaatgcatttatcaagcaagtatggtcctatttcttacaaagaacaattccgaagtgaaaatcctaagaaatggatctgtgacaaggatttccagactgtattaccatcatttgagctcttctcaaagtatggaaaattatattcaaaagctggacagattgtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - spermatogenesis associated 22
- LIM and cysteine-rich domains 1
- ubiquitin specific peptidase 12
- clusterin associated protein 1

Buy SPATA17-spermatogenesis associated 17 Gene now

Add to cart