Login to display prices
Login to display prices
USP12-ubiquitin specific peptidase 12 Gene View larger

USP12-ubiquitin specific peptidase 12 Gene

PTXBC026072

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of USP12-ubiquitin specific peptidase 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about USP12-ubiquitin specific peptidase 12 Gene

Proteogenix catalog: PTXBC026072
Ncbi symbol: USP12
Product name: USP12-ubiquitin specific peptidase 12 Gene
Size: 2ug
Accessions: BC026072
Gene id: 219333
Gene description: ubiquitin specific peptidase 12
Synonyms: UBH1; USP12L1; ubiquitin carboxyl-terminal hydrolase 12; deubiquitinating enzyme 12; ubiquitin specific protease 12 like 1; ubiquitin thioesterase 12; ubiquitin thiolesterase 12; ubiquitin-hydrolyzing enzyme 1; ubiquitin-specific-processing protease 12; ubiquitin specific peptidase 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaatcctaatgacagtctccaaattcgcctccatctgtaccatgggcgccaatgcttcggcattagagaaagagattggtccagaacagtttccggtcaatgagcactattttggattagtcaattttgggaatacctgctactgcaattcagttcttcaagcactttatttttgtcgtccatttcgggaaaaagttcttgcgtataagagtcaacctaggaaaaaggagagccttcttacatgcttagcagatctcttccatagcatagccactcagaagaaaaaggttggagtaataccccctaagaagttcatcacaagattacggaaagaaaatgagctttttgacaactacatgcaacaagatgcccatgaattcttaaattacctactaaatacaattgctgatattttacaagaagagagaaagcaggaaaaacaaaatggtcgtttacctaatggtaatattgataatgaaaataataacagcacaccagacccaacgtgggttgatgagatttttcagggaacattaactaatgaaaccagatgtcttacttgtgaaactataagcagcaaagatgaagattttttagacctttctgttgacgtggaacaaaatacatcaattactcactgcttaaggggtttcagcaacacagaaactctgtgcagtgaatacaagtattactgtgaagagtgtcgcagcaaacaggaagcacacaaacggatgaaagttaaaaaactgcccatgattctagctctacacctgaagagatttaaatatatggatcaacttcatcgatatacaaaactctcttaccgggtagtttttcctttagaacttcgtctgtttaacacttcaggtgatgccaccaatccagacagaatgtacgaccttgttgctgttgtggttcactgtggaagtggtcccaatcgaggccattatattgcaatagttaagagtcatgatttttggttgttgtttgatgacgacattgtagaaaaaatagatgcacaagctattgaagaattctacgggttgacatcagatatctcaaagaactctgagtctggttacatccttttctatcagtctcgggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: