BFAR-bifunctional apoptosis regulator Gene View larger

BFAR-bifunctional apoptosis regulator Gene

PTXBC003054

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BFAR-bifunctional apoptosis regulator Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BFAR-bifunctional apoptosis regulator Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003054
Product type: DNA & cDNA
Ncbi symbol: BFAR
Origin species: Human
Product name: BFAR-bifunctional apoptosis regulator Gene
Size: 2ug
Accessions: BC003054
Gene id: 51283
Gene description: bifunctional apoptosis regulator
Synonyms: RNF47; bifunctional apoptosis regulator; RING finger protein 47; bifunctional apoptosis inhibitor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaacctcagaaaagctatgtgaacacaatggaccttgagagagatgaacctctcaaaagcaccggccctcagatttctgttagtgaattttcttgccactgctgctacgacatcctggttaaccccaccaccttgaactgtgggcacagcttctgccgtcactgccttgctttatggtgggcatcttcaaagaaaacagaatgtccagaatgcagagaaaaatgggaaggtttccccaaagtcagtattctcctcagggatgccattgaaaagttatttcctgatgccattagactgagatttgaagacattcagcagaataatgacatagtccaaagtcttgcagcctttcagaaatatgggaatgatcagattcctttagctcctaacacaggccgagcgaatcagcagatgggagggggattcttttccggtgtgctcacagctttaactggagtggcagtggtcctgctcgtctatcactggagcagcagggaatctgaacacgacctcctggtccacaaggctgtggccaaatggacggcggaagaagttgtcctctggctggagcagctgggcccttgggcatctctttacagggaaaggtttttatctgaacgagtaaatggaaggttgcttttaactttgacagaggaagaattttccaagacgccctataccatagaaaacagcagccacaggagagccatcctcatggagctagaacgtgtcaaagcattaggcgtgaagcccccccagaatctctgggaatataaggctgtgaacccaggcaggtccctgttcctgctatacgccctcaagagctcccccaggctgagtctgctctacctgtacctgtttgactacaccgacaccttcctacctttcatccacaccatctgccctctgcaagaagacagctctggggaggacatcgtcaccaagcttctggatcttaaggagcctacgtggaagcagtggagagagttcctggtcaaatactccttccttccataccagctgattgctgagtttgcttgggactggttggaggtccattactggacatcacggtttctcatcatcaatgctatgttactctcagttctggaattattctccttttggagaatctggtcgagaagtgaactgaagaccgtgcctcagaggatgtggagccatttctggaaagtatcaacgcaggggctttttgtggccatgttctggcccctcatccctcagtttgtttgcaactgtttgttttactgggccctgtactttaacccaattattaacattgatcttgtggtcaaggaactccggcggctggaaacccaggtgttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein-coupled receptor 89A
- 4-aminobutyrate aminotransferase
- aarF domain containing kinase 4
- ubiquitin specific peptidase 49

Buy BFAR-bifunctional apoptosis regulator Gene now

Add to cart