ABAT-4-aminobutyrate aminotransferase Gene View larger

ABAT-4-aminobutyrate aminotransferase Gene


New product

Data sheet of ABAT-4-aminobutyrate aminotransferase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ABAT-4-aminobutyrate aminotransferase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031413
Product type: DNA & cDNA
Ncbi symbol: ABAT
Origin species: Human
Product name: ABAT-4-aminobutyrate aminotransferase Gene
Size: 2ug
Accessions: BC031413
Gene id: 18
Gene description: 4-aminobutyrate aminotransferase
Synonyms: GABA-AT; GABAT; NPD009; 4-aminobutyrate aminotransferase, mitochondrial; (S)-3-amino-2-methylpropionate transaminase; 4-aminobutyrate transaminase; GABA aminotransferase; GABA transaminase; GABA transferase; gamma-amino-N-butyrate transaminase; 4-aminobutyrate aminotransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctccatgttgctcgcccagcgcctggcctgcagcttccagcacagctaccgcctgctggtgcctggatccagacacattagtcaagctgcagccaaagtcgacgttgaatttgattatgatgggcctctgatgaagacggaagtcccagggcctagatctcgggagttaatgaaacagctgaatataattcagaatgcagaggctgtgcattttttctgcaattacgaagagagccgaggcaattacctggttgatgtggacggcaaccgaatgctggatctttattcccagatctcctctgtccccataggttacagccaccccgccctgctgaaactcatccaacagcctcaaaatgcgagcatgtttgtcaacagacccgccctcggaatcctgcctccggagaactttgtggagaagctccggcagtccttgctctcggtggctcccaaagggatgtcccagctcatcaccatggcctgcggctcctgctccaatgaaaacgccttaaagaccatcttcatgtggtaccggagcaaggaaagagggcagaggggcttctcccaggaggagctggagacgtgcatgattaaccaggcccctggctgccccgactacagcatcctctccttcatgggcgcgttccatgggaggaccatgggttgcttagcgaccacgcactctaaagccattcacaagatcgacatcccttcctttgactggcccatcgcaccgttcccacggctgaaataccctctggaagagtttgtgaaagagaaccaacaggaggaggcccgctgtctggaagaggtggaggatctgattgtgaaatatcggaaaaagaagaagacggtggccgggatcatcgtggagcccatccagtccgagggtggagacaaccacgcatccgatgacttctttcggaagctgagagacatcgccaggaagcatggctgcgccttcttggtggacgaggtacagaccggaggaggctgcacgggcaagttctgggcccatgagcactggggcctggatgacccagcagacgtgatgaccttcagcaagaaaatgatgactgggggcttcttccacaaggaggagttcaggcctaatgctccctaccggatcttcaacacctggctgggggacccgtccaagaacctgttgctggctgaggtcatcaacatcatcaagcgggaggacctgctaaataatgcagcccatgccgggaaggccctgctcacaggactgctggacctccaggcccggtacccccagttcatcagcagggtgagaggacgaggcaccttttgctccttcgatactcccgatgattccatacggaataagctcattttaattgccagaaacaaaggtgtggtgttgggtggctgtggtgacaaatccattcgtttccgtcccacgctggtcttcagggatcaccacgctcacctgttcctcaatattttcagtgacatcttagcagacttcaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aarF domain containing kinase 4
- ubiquitin specific peptidase 49
- zinc finger protein 23 (KOX 16)
- synaptic vesicle glycoprotein 2B

Buy ABAT-4-aminobutyrate aminotransferase Gene now

Add to cart