SPATA22-spermatogenesis associated 22 Gene View larger

SPATA22-spermatogenesis associated 22 Gene

PTXBC029483

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPATA22-spermatogenesis associated 22 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPATA22-spermatogenesis associated 22 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029483
Product type: DNA & cDNA
Ncbi symbol: SPATA22
Origin species: Human
Product name: SPATA22-spermatogenesis associated 22 Gene
Size: 2ug
Accessions: BC029483
Gene id: 84690
Gene description: spermatogenesis associated 22
Synonyms: NYD-SP20; NYDSP20; spermatogenesis-associated protein 22; testicular tissue protein Li 186; testis development protein NYD-SP20; spermatogenesis associated 22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcgaagcctaaatgaaaattcagctcgaagtacagcaggctgtttgcctgttccgttgttcaatcagaaaaagaggaacagacagccattaacttctaatccacttaaagatgattcaggtatcagtaccccttctgacaattatgattttcctcctctacctacagattgggcctgggaagctgtgaatccagagttggctcctgtaatgaaaacagtggacaccgggcaaataccacattcagtttctcgtcctctgagaagtcaagattctgtctttaactctattcaatcaaatactggaagaagccagggtggttggagctacagagatggtaacaaaaataccagcttgaaaacttggaataaaaatgattttaagcctcaatgtaaacgaacaaacttagtggcaaatgatggaaaaaattcttgtccaatgagttcgggagctcaacaacaaaaacaattaagaacacctgaacctcctaacttatctcgcaacaaagaaaccgagctactcagacaaacacattcatcaaaaatatctggctgcacaatgagagggctagacaaaaacagtgcactacagacacttaagcccaattttcaacaaaatcaatataagaaacaaatgttggatgatattccagaagacaacaccctgaaggaaacctcattgtatcagttacagtttaaggaaaaagctagttctttaagaattatttctgcagttattgaaagcatgaagtattggcgtgaacatgcacagaaaactgtacttctttttgaagtattagctgttcttgattcagctgttacacctggcccatattattcgaagacttttcttatgagggatgggaaaaatactctgccttgtgtcttttatgaaatcgatcgtgaacttccgagactgattagaggccgagttcatagatgtgttggcaactatgaccagaaaaagaacattttccaatgtgtttctgtcagaccggcgtctgtttctgagcaaaaaactttccaggcatttgtcaaaattgcagatgttgagatgcagtattatattaatgtgatgaatgaaacttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LIM and cysteine-rich domains 1
- ubiquitin specific peptidase 12
- clusterin associated protein 1
- RUN and SH3 domain containing 1

Buy SPATA22-spermatogenesis associated 22 Gene now

Add to cart