Login to display prices
Login to display prices
MLKL-mixed lineage kinase domain-like Gene View larger

MLKL-mixed lineage kinase domain-like Gene

PTXBC028141

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MLKL-mixed lineage kinase domain-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MLKL-mixed lineage kinase domain-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028141
Product type: DNA & cDNA
Ncbi symbol: MLKL
Origin species: Human
Product name: MLKL-mixed lineage kinase domain-like Gene
Size: 2ug
Accessions: BC028141
Gene id: 197259
Gene description: mixed lineage kinase domain-like
Synonyms: hMLKL; mixed lineage kinase domain-like protein; mixed lineage kinase domain like pseudokinase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaaatttgaagcatattatcacccttggccaggtcatccacaaacggtgtgaagagatgaaatactgcaagaaacagtgccggcgcctgggccaccgcgtcctcggcctgatcaagcctctggagatgctccaggaccaaggaaagaggagcgtgccctctgagaagttaaccacagccatgaaccgcttcaaggctgccctggaggaggctaatggggagatagaaaagttcagcaatagatccaatatctgcaggtttctaacagcaagccaggacaaaatactcttcaaggacgtgaacaggaagctgagtgatgtctggaaggagctctcgctgttacttcaggttgagcaacgcatgcctgtttcacccataagccaaggagcgtcctgggcacaggaagatcagcaggatgcagacgaagacaggcgagctttccagatgctaagaagagataatgaaaaaatagaagcttcactgagacgattagaaatcaacatgaaagaaatcaaggaaactttgaggcagtctttggaatcgtcctctgggaaatcgccactggagatatcccgtttcaaggtgaagaatgtgaagactggctcagccagtggctgtaattctgagaagatccgcaagctggtggctgtgaagcggcagcaggagccactgggtgaagactgcccttcagagctgcgggagatcattgatgagtgccgggcccatgatccctctgtgcggccctctgtggatgaaatcttaaagaaactctccaccttttctaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - asteroid homolog 1 (Drosophila)
- plasticity related gene 3
- ADP-ribosylation factor-like 17
- melanoma antigen family B, 18