Login to display prices
Login to display prices
ARL4D-ADP-ribosylation factor-like 4D Gene View larger

ARL4D-ADP-ribosylation factor-like 4D Gene

PTXBC000043

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARL4D-ADP-ribosylation factor-like 4D Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARL4D-ADP-ribosylation factor-like 4D Gene

Proteogenix catalog: PTXBC000043
Ncbi symbol: ARL4D
Product name: ARL4D-ADP-ribosylation factor-like 4D Gene
Size: 2ug
Accessions: BC000043
Gene id: 379
Gene description: ADP-ribosylation factor-like 4D
Synonyms: ARF4L; ARL6; ADP-ribosylation factor-like protein 4D; ADP-ribosylation factor-like 4D; ADP-ribosylation factor-like 6; ADP-ribosylation factor-like protein 4L; ADP ribosylation factor like GTPase 4D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaaccacttgactgagatggcgcccactgcctcctccttcttgccccacttccaagccctgcatgtcgtggtcattgggctggactctgctggaaagacctccctcctttaccgcctcaagttcaaggagtttgtccagagtgtccccaccaaaggcttcaacaccgagaagatccgggtgcccctcgggggatcgcgtggcatcaccttccaagtgtgggacgtcggggggcaggagaagctgcgaccactgtggcgctcttatacccgccggacagacggtctagtgtttgtggtggacgctgcggaggctgagcggctggaggaagccaaggtggagttgcaccgaatcagccgggcctcggacaaccagggcgtgccagtgctggtgctggccaacaagcaggaccagcccggggcactgagcgctgctgaggtggagaagaggctggcagtccgagagctagcagccgccactctcactcatgtgcaaggctgcagcgctgtggacggtctgggcctgcagcagggccttgagcgcctctatgagatgatcctcaagaggaagaaggcagctcggggtggcaagaagagacggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: