ARL4A-ADP-ribosylation factor-like 4A Gene View larger

ARL4A-ADP-ribosylation factor-like 4A Gene

PTXBC001111

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARL4A-ADP-ribosylation factor-like 4A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARL4A-ADP-ribosylation factor-like 4A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001111
Product type: DNA & cDNA
Ncbi symbol: ARL4A
Origin species: Human
Product name: ARL4A-ADP-ribosylation factor-like 4A Gene
Size: 2ug
Accessions: BC001111
Gene id: 10124
Gene description: ADP-ribosylation factor-like 4A
Synonyms: ADP-ribosylation factor-like protein 4A; ADP-ribosylation factor-like 4; ADP-ribosylation factor-like 4A; ADP ribosylation factor like GTPase 4A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaatgggctgtcagaccagacttctatcctgtccaacctgccttcatttcagtctttccacattgttattctgggtttggactgtgctggaaagacaactgtcttatacaggctgcagttcaatgaatttgtaaataccgtacctaccaaaggatttaacactgagaaaattaaggtaaccttgggaaattctaaaacagtcacttttcacttctgggatgtaggtggtcaggagaaattaaggccactgtggaagtcatataccagatgcacagatggcattgtatttgttgtggactctgttgatgtcgaaaggatggaagaagccaaaactgaacttcacaaaataactaggatatcagaaaatcagggagtccctgtacttatagttgctaacaaacaagatttgaggaactcattgtcactttcagaaattgagaaattgttagcaatgggtgaactgagctcatcaactccttggcatttgcagcctacctgtgcaatcataggagatggcctaaaggaaggacttgagaaactacatgatatgatcattaaaagaagaaaaatgttgcggcaacagaaaaagaaaagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADP-ribosylation factor-like 4D
- chromatin modifying protein 2A
- mixed lineage kinase domain-like
- asteroid homolog 1 (Drosophila)

Buy ARL4A-ADP-ribosylation factor-like 4A Gene now

Add to cart