Login to display prices
Login to display prices
RABL4-RAB, member of RAS oncogene family-like 4 Gene View larger

RABL4-RAB, member of RAS oncogene family-like 4 Gene

PTXBC000566

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RABL4-RAB, member of RAS oncogene family-like 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RABL4-RAB, member of RAS oncogene family-like 4 Gene

Proteogenix catalog: PTXBC000566
Ncbi symbol: RABL4
Product name: RABL4-RAB, member of RAS oncogene family-like 4 Gene
Size: 2ug
Accessions: BC000566
Gene id: 11020
Gene description: RAB, member of RAS oncogene family-like 4
Synonyms: RABL4; BBS19; RAYL; intraflagellar transport protein 27 homolog; RAB, member of RAS oncogene family-like 4; rab-like protein 4; intraflagellar transport 27
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgaagctggcagccaaatgcatcctggcaggagacccagcagtgggcaagaccgccctggcacagatcttccgcagtgatggagcccatttccagaaaagctacaccctgacaacaggaatggatttggtggtgaagacagtgccagttcctgacacgggagacagtgtggaactcttcatttttgactctgctggcaaggagctgttttcggaaatgctggataaattgtgggagagtcccaatgtcttatgtctcgtctatgatgtgaccaatgaagaatccttcaacaactgcagcaagtggctggagaaggctcggtcacaggctccaggcatctctctcccaggtgttttagttgggaacaagacagacctggccggcagacgagcagtggactcagctgaggcccgggcatgggcgctgggccagggcctggaatgttttgaaacatccgtgaaagagatggaaaacttcgaagcccctttccactgccttgccaagcagttccaccagctgtaccgggagaaggtggaggttttccgggccctggcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: