PTXBC000566
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000566 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RABL4 |
| Origin species: | Human |
| Product name: | RABL4-RAB, member of RAS oncogene family-like 4 Gene |
| Size: | 2ug |
| Accessions: | BC000566 |
| Gene id: | 11020 |
| Gene description: | RAB, member of RAS oncogene family-like 4 |
| Synonyms: | RABL4; BBS19; RAYL; intraflagellar transport protein 27 homolog; RAB, member of RAS oncogene family-like 4; rab-like protein 4; intraflagellar transport 27 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgaagctggcagccaaatgcatcctggcaggagacccagcagtgggcaagaccgccctggcacagatcttccgcagtgatggagcccatttccagaaaagctacaccctgacaacaggaatggatttggtggtgaagacagtgccagttcctgacacgggagacagtgtggaactcttcatttttgactctgctggcaaggagctgttttcggaaatgctggataaattgtgggagagtcccaatgtcttatgtctcgtctatgatgtgaccaatgaagaatccttcaacaactgcagcaagtggctggagaaggctcggtcacaggctccaggcatctctctcccaggtgttttagttgggaacaagacagacctggccggcagacgagcagtggactcagctgaggcccgggcatgggcgctgggccagggcctggaatgttttgaaacatccgtgaaagagatggaaaacttcgaagcccctttccactgccttgccaagcagttccaccagctgtaccgggagaaggtggaggttttccgggccctggcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 - eukaryotic translation initiation factor 6 - FGGY carbohydrate kinase domain containing - serine peptidase inhibitor, Kazal type 1 |