Cart 37 Product Products 8 336,10 € (empty)
-
1 x HIATL1-hip...121,50 € -
-
1 x PIP4K2A-ph...121,50 € -
1 x FAM177A1-f...113,40 € -
1 x DUSP6-dual...121,50 € -
1 x S100B-S100...113,40 € -
1 x NCOA7-nucl...113,40 € -
-
-
1 x PIP4K2B-ph...121,50 € -
1 x FAM176A-fa...113,40 € -
1 x ZZZ3-zinc...121,50 € -
1 x PIPOX-pipe...121,50 € -
1 x PIK3R5-pho...121,50 € -
1 x GPR1-G...121,50 € -
-
1 x RPA3-repli...113,40 € -
1 x DYNLRB1-dy...113,40 € -
1 x PIM1-pim-1...121,50 € -
1 x FAM133A-fa...113,40 € -
-
-
1 x RPL13-ribo...113,40 € -
1 x DUSP7-dual...121,50 € -
1 x PIPOX-pipe...121,50 € -
1 x PID1-phosp...113,40 € -
1 x TMEM116-tr...113,40 € -
1 x DYNLRB2-dy...113,40 € -
1 x FAM128B-fa...113,40 € -
-
-
1 x FAM118B-fa...121,50 € -
1 x CDO1-cyste...113,40 € -
1 x TMEM110-tr...121,50 € -
-
-
1 x FAM171A2-f...113,40 €
No products
To be determined Shipping
8 336,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 37 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 8 336,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 8 336,10 €
View larger 
FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene
PTXBC001107
New product
Data sheet of FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001107 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FUSIP1 |
| Origin species: | Human |
| Product name: | FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene |
| Size: | 2ug |
| Accessions: | BC001107 |
| Gene id: | 10772 |
| Gene description: | FUS interacting protein (serine/arginine-rich) 1 |
| Synonyms: | FUSIP1; FUSIP2; NSSR; PPP1R149; SFRS13; SFRS13A; SRp38; SRrp40; TASR; TASR1; TASR2; serine/arginine-rich splicing factor 10; 40 kDa SR-repressor protein; FUS interacting protein (serine-arginine rich) 1; FUS-interacting protein (serine-arginine rich) 2; SR splicing factor 10; TLS-associated SR protein; TLS-associated protein TASR; TLS-associated protein with SR repeats; TLS-associated protein with Ser-Arg repeats; TLS-associated serine-arginine protein 1; TLS-associated serine-arginine protein 2; neural-salient SR protein; protein phosphatase 1, regulatory subunit 149; serine-arginine repressor protein (40 kDa); splicing factor SRp38; splicing factor, arginine/serine-rich 13; splicing factor, arginine/serine-rich 13A; serine and arginine rich splicing factor 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcccgctacctgcgtccccccaacacgtctctgttcgtcaggaacgtggccgacgacaccaggtctgaagacttgcggcgtgaatttggtcgttatggtcctatagttgatgtgtatgttccacttgatttctacactcgccgtccaagaggatttgcttatgttcaatttgaggatgttcgtgatgctgaagacgctttacataatttggacagaaagtggatttgtggacggcagattgaaatacagtttgcccagggggatcgaaagacaccaaatcagatgaaagccaaggaagggaggaatgtgtacagttcttcacgctatgatgattatgacagatacagacgttctagaagccgaagttatgaaaggaggagatcaagaagtcggtcttttgattacaactatagaagatcgtatagtcctagaaacagtagaccgactggaagaccacggcgtagcagaagccattccgacaatgatagaccaaactgcagctggaatacccagtacagttctgcttactacacttcaagaaagatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cyclin-dependent kinase inhibitor 1B (p27, Kip1) - heterogeneous nuclear ribonucleoprotein A2/B1 - C1q and tumor necrosis factor related protein 1 - chromobox homolog 4 (Pc class homolog, Drosophila) |