HNRNPA2B1-heterogeneous nuclear ribonucleoprotein A2/B1 Gene View larger

HNRNPA2B1-heterogeneous nuclear ribonucleoprotein A2/B1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HNRNPA2B1-heterogeneous nuclear ribonucleoprotein A2/B1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HNRNPA2B1-heterogeneous nuclear ribonucleoprotein A2/B1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000506
Product type: DNA & cDNA
Ncbi symbol: HNRNPA2B1
Origin species: Human
Product name: HNRNPA2B1-heterogeneous nuclear ribonucleoprotein A2/B1 Gene
Size: 2ug
Accessions: BC000506
Gene id: 3181
Gene description: heterogeneous nuclear ribonucleoprotein A2/B1
Synonyms: HNRNPA2; HNRNPB1; HNRPA2; HNRPA2B1; HNRPB1; IBMPFD2; RNPA2; SNRPB1; heterogeneous nuclear ribonucleoproteins A2/B1; hnRNP A2 / hnRNP B1; nuclear ribonucleoprotein particle A2 protein; heterogeneous nuclear ribonucleoprotein A2/B1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagagaaaaggaacagttccgtaagctctttattggtggcttaagctttgaaaccacagaagaaagtttgaggaactactacgaacaatggggaaagcttacagactgtgtggtaatgagggatcctgcaagcaaaagatcaagaggatttggttttgtaactttttcatccatggctgaggttgatgctgccatggctgcaagacctcattcaattgatgggagagtagttgagccaaaacgtgctgtagcaagagaggaatctggaaaaccaggggctcatgtaactgtgaagaagctgtttgttggcggaattaaagaagatactgaggaacatcaccttagagattactttgaggaatatggaaaaattgataccattgagataattactgataggcagtctggaaagaaaagaggctttggctttgttacttttgatgaccatgatcctgtggataaaatcgtattgcagaaataccataccatcaatggtcataatgcagaagtaagaaaggctttgtctagacaagaaatgcaggaggacctggaggtggcaattttggaggtagccccggttatggaggaggaagaggaggatatggtggtggaggacctggatatggcaaccagggtgggggctacggaggtggttatgacaactatggaggaggaaattatggaagtggaaattacaatgattttggaaattataaccagcaaccttctaactacggtccaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - C1q and tumor necrosis factor related protein 1
- chromobox homolog 4 (Pc class homolog, Drosophila)
- Yip1 interacting factor homolog B (S. cerevisiae)
- heat shock protein 90kDa beta (Grp94), member 1

Buy HNRNPA2B1-heterogeneous nuclear ribonucleoprotein A2/B1 Gene now

Add to cart