Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
C1QTNF1-C1q and tumor necrosis factor related protein 1 Gene
PTXBC021553
New product
Data sheet of C1QTNF1-C1q and tumor necrosis factor related protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C1QTNF1-C1q and tumor necrosis factor related protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021553 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C1QTNF1 |
| Origin species: | Human |
| Product name: | C1QTNF1-C1q and tumor necrosis factor related protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC021553 |
| Gene id: | 114897 |
| Gene description: | C1q and tumor necrosis factor related protein 1 |
| Synonyms: | CTRP1; GIP; ZSIG37; complement C1q tumor necrosis factor-related protein 1; G protein coupled receptor interacting protein; g protein-coupled receptor-interacting protein; C1q and tumor necrosis factor related protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggctcccgtggacagggactcttgctggcgtactgcctgctccttgcctttgcctctggcctggtcctgagtcgtgtgccccatgtccagggggaacagcaggagtgggaggggactgaggagctgccgtcgcctccggaccatgccgagagggctgaagaacaacatgaaaaatacaggcccagtcaggaccaggggctccctgcttcccggtgcttgcgctgctgtgaccccggtacctccatgtacccggcgaccgccgtgccccagatcaacatcactatcttgaaaggggagaagggtgaccgcggagatcgaggcctccaagggaaatatggcaaaacaggctcagcaggggccaggggccacactggacccaaagggcagaagggctccatgggggcccctggggagcggtgcaagagccactacgccgccttttcggtgggccggaagaagcccatgcacagcaaccactactaccagacggtgatcttcgacacggagttcgtgaacctctacgaccacttcaacatgttcaccggcaagttctactgctacgtgcccggcctctacttcttcagcctcaacgtgcacacctggaaccagaaggagacctacctgcacatcatgaagaacgaggaggaggtggtgatcttgttcgcgcaggtgggcgaccgcagcatcatgcaaagccagagcctgatgctggagctgcgagagcaggaccaggtgtgggtacgcctctacaagggcgaacgtgagaacgccatcttcagcgaggagctggacacctacatcaccttcagtggctacctggtcaagcacgccaccgagccctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromobox homolog 4 (Pc class homolog, Drosophila) - Yip1 interacting factor homolog B (S. cerevisiae) - heat shock protein 90kDa beta (Grp94), member 1 - beta-1,4-N-acetyl-galactosaminyl transferase 1 |