Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CBX4-chromobox homolog 4 (Pc class homolog, Drosophila) Gene
PTXBC014967
New product
Data sheet of CBX4-chromobox homolog 4 (Pc class homolog, Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CBX4-chromobox homolog 4 (Pc class homolog, Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014967 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CBX4 |
| Origin species: | Human |
| Product name: | CBX4-chromobox homolog 4 (Pc class homolog, Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC014967 |
| Gene id: | 8535 |
| Gene description: | chromobox homolog 4 (Pc class homolog, Drosophila) |
| Synonyms: | E3 SUMO-protein ligase CBX4; NBP16; PC2; NS5ATP1-binding protein 16; Pc class 2 homolog; chromobox homolog 4 (Pc class homolog, Drosophila); chromobox protein homolog 4; chromobox-like protein 4; polycomb 2 homolog; chromobox 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagctgccagctgttggcgagcacgtcttcgcggtggagagcatcgagaagaagcggatccgcaagggcagagtggagtatctggtgaaatggagaggctggtcgcccaaatataacacgtgggaaccggaggagaacatcctggaccccaggctgctgatcgccttccagaacagggaacggcaggagcagctgatgggatatcggaagagagggccgaagcccaaaccgctagtggtgcaggtgcctacctttgcccgtcgttccaatgtcctgaccggcctccaggactcctccactgacaaccgtgccaagctggatttgggcgcgcaggggaagggccaggggcatcagtacgagctcaacagcaagaagcaccaccaccacgccgtcggcctgaatctctcccacgtgcgcaagcgctgcctctccgagacccacggcgagcgcgagccctgcaagaagcggctgactgcgcgcagcatcagcacccccacctgcctggggggcagcccagccgctgagcgcccggccgacctgccaccagccgccgccctcccgcagcccgaggtcatcctgctagactcagacctggatgaacccatagacttgcgctgcgtcaagacgcgcagcgaggccggggagccgcccagctccctccaggtgaagcccgagacaccggcgtcggcggcggtggcggtggcggcggcagcggcacccaccacgacggcggagaagcctccagccgaggcccaggacgaacctgcagagtcgctgagcgagttcaagcccttctttgggaatataattatcaccgacgtcaccgcgaactgcctcaccgttactttcaaggagtacgtgacggtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Yip1 interacting factor homolog B (S. cerevisiae) - heat shock protein 90kDa beta (Grp94), member 1 - beta-1,4-N-acetyl-galactosaminyl transferase 1 - pyrimidinergic receptor P2Y, G-protein coupled, 6 |