Login to display prices
Login to display prices
CDKN1B-cyclin-dependent kinase inhibitor 1B (p27, Kip1) Gene View larger

CDKN1B-cyclin-dependent kinase inhibitor 1B (p27, Kip1) Gene

PTXBC001971

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDKN1B-cyclin-dependent kinase inhibitor 1B (p27, Kip1) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDKN1B-cyclin-dependent kinase inhibitor 1B (p27, Kip1) Gene

Proteogenix catalog: PTXBC001971
Ncbi symbol: CDKN1B
Product name: CDKN1B-cyclin-dependent kinase inhibitor 1B (p27, Kip1) Gene
Size: 2ug
Accessions: BC001971
Gene id: 1027
Gene description: cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Synonyms: CDKN4; KIP1; MEN1B; MEN4; P27KIP1; cyclin-dependent kinase inhibitor 1B; cyclin-dependent kinase inhibitor 1B (p27, Kip1); cyclin dependent kinase inhibitor 1B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcaaacgtgcgagtgtctaacgggagccctagcctggagcggatggacgccaggcaggcggagcaccccaagccctcggcctgcaggaacctcttcggcccggtggaccacgaagagttaacccgggacttggagaagcactgcagagacatggaagaggcgagccagcgcaagtggaatttcgattttcagaatcacaaacccctagagggcaagtacgagtggcaagaggtggagaagggcagcttgcccgagttctactacagacccccgcggccccccaaaggtgcctgcaaggtgccggcgcaggagagccaggatggcagcgggagccgcccggcggcgcctttaattggggctccggctaactctgaggacacgcatttggtggacccaaagactgatccgtcggacagccagacggggttagcggagcaatgcgcaggaataaggaagcgacctgcaaccgacgattcttctactcaaaacaaaagagccaacagaacagaagaaaatgtttcagacggttccccaaatgccggttctgtggagcagacgcccaagaagcctggcctcagaagacgtcaaacgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: