Login to display prices
Login to display prices
NIP7-nuclear import 7 homolog (S. cerevisiae) Gene View larger

NIP7-nuclear import 7 homolog (S. cerevisiae) Gene

PTXBC015941

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NIP7-nuclear import 7 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NIP7-nuclear import 7 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC015941
Ncbi symbol: NIP7
Product name: NIP7-nuclear import 7 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC015941
Gene id: 51388
Gene description: nuclear import 7 homolog (S. cerevisiae)
Synonyms: NIP7, nucleolar pre-rRNA processing protein; 60S ribosome subunit biogenesis protein NIP7 homolog; CGI-37; HSPC031; KD93; nuclear import 7 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggcctttgactgaagaggagacccgtgtcatgtttgagaagatagcgaaatacattggggagaatcttcaactgctggtggaccggcccgatggcacctactgtttccgtctgcacaacgaccgggtgtactatgtgagtgagaagattatgaagctggccgccaatatttccggggacaagctggtgtcgctggggacctgctttggaaaattcactaaaacccacaagtttcggttgcacgtcacagctctggattaccttgcaccttatgccaagtataaagtttggataaagcctggtgcagagcagtccttcctgtatgggaaccatgtgttgaaatctggtctgggtcgaatcactgaaaatacttctcagtaccagggcgtggtggtgtactccatggcagacatccctttgggttttggggtggcagccaaatctacacaagactgcagaaaagtagaccccatggcgattgtggtatttcatcaagcagacattggggaatatgtgcggcatgaagagacgttgacttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: