PTXBC015941
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015941 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NIP7 |
| Origin species: | Human |
| Product name: | NIP7-nuclear import 7 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC015941 |
| Gene id: | 51388 |
| Gene description: | nuclear import 7 homolog (S. cerevisiae) |
| Synonyms: | NIP7, nucleolar pre-rRNA processing protein; 60S ribosome subunit biogenesis protein NIP7 homolog; CGI-37; HSPC031; KD93; nuclear import 7 homolog |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggcctttgactgaagaggagacccgtgtcatgtttgagaagatagcgaaatacattggggagaatcttcaactgctggtggaccggcccgatggcacctactgtttccgtctgcacaacgaccgggtgtactatgtgagtgagaagattatgaagctggccgccaatatttccggggacaagctggtgtcgctggggacctgctttggaaaattcactaaaacccacaagtttcggttgcacgtcacagctctggattaccttgcaccttatgccaagtataaagtttggataaagcctggtgcagagcagtccttcctgtatgggaaccatgtgttgaaatctggtctgggtcgaatcactgaaaatacttctcagtaccagggcgtggtggtgtactccatggcagacatccctttgggttttggggtggcagccaaatctacacaagactgcagaaaagtagaccccatggcgattgtggtatttcatcaagcagacattggggaatatgtgcggcatgaagagacgttgacttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane and coiled-coil domains 1 - prostaglandin D2 synthase 21kDa (brain) - ankyrin repeat and SOCS box-containing 6 - glutamate decarboxylase 1 (brain, 67kDa) |