DCTN3-dynactin 3 (p22) Gene View larger

DCTN3-dynactin 3 (p22) Gene

PTXBC000319

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DCTN3-dynactin 3 (p22) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DCTN3-dynactin 3 (p22) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000319
Product type: DNA & cDNA
Ncbi symbol: DCTN3
Origin species: Human
Product name: DCTN3-dynactin 3 (p22) Gene
Size: 2ug
Accessions: BC000319
Gene id: 11258
Gene description: dynactin 3 (p22)
Synonyms: DCTN-22; DCTN22; dynactin subunit 3; dynactin 3 (p22); dynactin complex subunit 22 kDa subunit; dynactin light chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggtctgactgacttgcagcggctacaggcccgagtggaagagctggagcgctgggtgtacgggccgggcggggcgcgcggctcacggaaggtggctgacggcctggtcaaggtgcaggtggctttggggaacatttccagcaagagggagagggtgaagattctctacaaaaagattgaagatctgatcaagtacctggatcctgagtacatcgaccgcattgccatacctgatgcctctaagctgcaattcatcctagcagaggagcagtttatcctttcccaggttgcactcctggagcaggtgaatgccttggtgcccatgctggacagtgctcacatcaaagccgttcctgagcatgctgcccgcctgcagcgcttggcccagatccacattcagcagcaggctccatggggagtgggagtccgtgatgaggcaggaagtttagtggaagatgtgggctttgcccagttcctttctgtgctacactttggccctacaggaccagtgtgtggaaatcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - adenylate kinase 1
- phosducin-like 2
- sorting nexin 11
- Obg-like ATPase 1

Buy DCTN3-dynactin 3 (p22) Gene now

Add to cart