C19orf43-chromosome 19 open reading frame 43 Gene View larger

C19orf43-chromosome 19 open reading frame 43 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf43-chromosome 19 open reading frame 43 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf43-chromosome 19 open reading frame 43 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000216
Product type: DNA & cDNA
Ncbi symbol: C19orf43
Origin species: Human
Product name: C19orf43-chromosome 19 open reading frame 43 Gene
Size: 2ug
Accessions: BC000216
Gene id: 79002
Gene description: chromosome 19 open reading frame 43
Synonyms: uncharacterized protein C19orf43; fSAP18; My029 protein; chromosome 19 open reading frame 43
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcccgagggagacgggcggagcctcagggccgggaggctccgggccccgcgggcggtggcggtggcgggagccgttgggctgagtcgggatcggggacgtcgcccgagagcggggacgaggaggtgtcgggcgcgggttcgagcccggtgtcgggcggcgtgaacttgttcgccaacgacggcagcttcctggagctgttcaagcggaagatggaggaggagcagcggcagcggcaggaggagccgcccccgggtccgcagcgacccgaccagtcggccgccgccgctggccccggggatccgaagaggaagggcggtccgggctccacacttagcttcgtgggcaaacgcagaggcgggaacaaactagccctcaagacgggaatagtagccaagaagcagaagacggaggatgaggtattaacaagtaaaggtgacgcgtgggccaagtacatggcagaagtgaaaaagtacaaagctcaccagtgcggtgacgatgataaaactcggcccctggtgaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB, member RAS oncogene family-like 5
- chromosome 12 open reading frame 45
- chromosome 11 open reading frame 73
- transmembrane 4 L six family member 4

Buy C19orf43-chromosome 19 open reading frame 43 Gene now

Add to cart