Login to display prices
Login to display prices
C11orf73-chromosome 11 open reading frame 73 Gene View larger

C11orf73-chromosome 11 open reading frame 73 Gene

PTXBC001677

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C11orf73-chromosome 11 open reading frame 73 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C11orf73-chromosome 11 open reading frame 73 Gene

Proteogenix catalog: PTXBC001677
Ncbi symbol: C11orf73
Product name: C11orf73-chromosome 11 open reading frame 73 Gene
Size: 2ug
Accessions: BC001677
Gene id: 51501
Gene description: chromosome 11 open reading frame 73
Synonyms: C11orf73; HLD13; HSPC138; HSPC179; L7RN6; OPI10; protein Hikeshi; lethal, Chr 7, Rinchik 6; Hikeshi, heat shock protein nuclear import factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttggctgcttggtggcggggaggctggtgcaaacagctgcacagcaagtggcagaggataaatttgtttttgacttacctgattatgaaagtatcaaccatgttgtggtttttatgctgggaacaatcccatttcctgagggaatgggaggatctgtctacttttcttatcctgattcaaatggaatgccagtatggcaactcctaggatttgtcacgaatgggaagccaagtgccatcttcaaaatttcaggtcttaaatctggagaaggaagccaacatccttttggagccatgaatattgtccgaactccatctgttgctcagattggaatttcagtggaattattagacagtatggctcagcagactcctgtaggtaatgctgctgtatcctcagttgactcattcactcagttcacacaaaagatgttggacaatttctacaattttgcttcatcatttgctgtctctcaggcccagatgacaccaagcccatctgaaatgttcattccggcaaatgtggttctgaaatggtatgaaaactttcaaagacgactagcacagaaccctctcttttggaaaacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: