C11orf73-chromosome 11 open reading frame 73 Gene View larger

C11orf73-chromosome 11 open reading frame 73 Gene

PTXBC001677

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C11orf73-chromosome 11 open reading frame 73 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C11orf73-chromosome 11 open reading frame 73 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001677
Product type: DNA & cDNA
Ncbi symbol: C11orf73
Origin species: Human
Product name: C11orf73-chromosome 11 open reading frame 73 Gene
Size: 2ug
Accessions: BC001677
Gene id: 51501
Gene description: chromosome 11 open reading frame 73
Synonyms: C11orf73; HLD13; HSPC138; HSPC179; L7RN6; OPI10; protein Hikeshi; lethal, Chr 7, Rinchik 6; Hikeshi, heat shock protein nuclear import factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttggctgcttggtggcggggaggctggtgcaaacagctgcacagcaagtggcagaggataaatttgtttttgacttacctgattatgaaagtatcaaccatgttgtggtttttatgctgggaacaatcccatttcctgagggaatgggaggatctgtctacttttcttatcctgattcaaatggaatgccagtatggcaactcctaggatttgtcacgaatgggaagccaagtgccatcttcaaaatttcaggtcttaaatctggagaaggaagccaacatccttttggagccatgaatattgtccgaactccatctgttgctcagattggaatttcagtggaattattagacagtatggctcagcagactcctgtaggtaatgctgctgtatcctcagttgactcattcactcagttcacacaaaagatgttggacaatttctacaattttgcttcatcatttgctgtctctcaggcccagatgacaccaagcccatctgaaatgttcattccggcaaatgtggttctgaaatggtatgaaaactttcaaagacgactagcacagaaccctctcttttggaaaacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane 4 L six family member 4
- chromosome 12 open reading frame 49
- chromosome 6 open reading frame 223
- chromosome 1 open reading frame 163

Buy C11orf73-chromosome 11 open reading frame 73 Gene now

Add to cart