C6orf223-chromosome 6 open reading frame 223 Gene View larger

C6orf223-chromosome 6 open reading frame 223 Gene

PTXBC032706

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C6orf223-chromosome 6 open reading frame 223 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C6orf223-chromosome 6 open reading frame 223 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032706
Product type: DNA & cDNA
Ncbi symbol: C6orf223
Origin species: Human
Product name: C6orf223-chromosome 6 open reading frame 223 Gene
Size: 2ug
Accessions: BC032706
Gene id: 221416
Gene description: chromosome 6 open reading frame 223
Synonyms: uncharacterized protein C6orf223; chromosome 6 open reading frame 223
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagggctcttttcaccagaagacccccaggcacaagcagcccaccttactgatggtcagagcatccagaagaagtggcaagacttcagctgtcctcaaagcaggaagacagagtgtttctggcagaaagaacagcacaagcaaagatctggtaaccctaggtgcctccagtttgagggaggagagaggacaccccctccaccccagacataggaaagcagtccacctgcgcaccaggggcaggacacgtggctgggtgcagacgctggcccggatgtcgcggaggactcgcgggccggtagagcgcgcggcggcggcggcggcggcggcggcggcgggaggagacgcaggtcacgcccccttcccaccacctcccgccgccgacggggcgcgcgcgccgaggagcccgggacaggtgactcctagaggactgcgtctgcgcctcccccggcgggagtcccttcttcgcggcctctgccgccccctgcgtcccctcctgggcttccgagagtctgactcagccaagccggcatcgcttcgcctcctacaacacaccccgagcgcgagaagaaattacaggattgcaggggcacggctaatgcgctctaattacccaccgccgctgtcatccgcggcgctccgcggcgctgggccaacgcgccgtaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 163
- 3-hydroxybutyrate dehydrogenase, type 2
- chromosome 12 open reading frame 60
- sulfotransferase family 4A, member 1

Buy C6orf223-chromosome 6 open reading frame 223 Gene now

Add to cart