BDH2-3-hydroxybutyrate dehydrogenase, type 2 Gene View larger

BDH2-3-hydroxybutyrate dehydrogenase, type 2 Gene

PTXBC001953

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BDH2-3-hydroxybutyrate dehydrogenase, type 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BDH2-3-hydroxybutyrate dehydrogenase, type 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001953
Product type: DNA & cDNA
Ncbi symbol: BDH2
Origin species: Human
Product name: BDH2-3-hydroxybutyrate dehydrogenase, type 2 Gene
Size: 2ug
Accessions: BC001953
Gene id: 56898
Gene description: 3-hydroxybutyrate dehydrogenase, type 2
Synonyms: EFA6R; PRO20933; SDR15C1; UCPA-OR; UNQ6308; 3-hydroxybutyrate dehydrogenase type 2; R-beta-hydroxybutyrate dehydrogenase; dehydrogenase/reductase SDR family member 6; oxidoreductase UCPA; short chain dehydrogenase/reductase family 15C member 1; 3-hydroxybutyrate dehydrogenase, type 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtcgacttgatgggaaagtcatcatcctgacggccgctgctcaggggattggccaagcagctgccttagcttttgcaagagaaggtgccaaagtcatagccacagacattaatgagtccaaacttcaggaactggaaaagtacccgggtattcaaactcgtgtccttgatgtcacaaagaagaaacaaattgatcagtttgccagtgaagttgagagacttgatgttctctttaatgttgctggttttgtccatcatggaactgtcctggattgtgaggagaaagactgggacttctcgatgaatctcaatgtgcgcagcatgtacctgatgatcaaggcattccttcctaaaatgcttgctcagaaatctggcaatattatcaacatgtcttctgtggcttccagcgtcaaaggagttgtgaacagatgtgtgtacagcacaaccaaggcagccgtgattggcctcacaaaatctgtggctgcagatttcatccagcagggcatcaggtgcaactgtgtgtgcccaggaacagttgatacgccatctctacaagaaagaatacaagccagaggaaatcctgaagaggcacggaatgatttcctgaagagacaaaagacgggaagattcgcaactgcagaagaaatagccatgctctgcgtgtatttggcttctgatgaatctgcttatgtaactggtaaccctgtcatcattgatggaggctggagcttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 12 open reading frame 60
- sulfotransferase family 4A, member 1
- chromosome 16 open reading frame 61
- chromosome 1 open reading frame 211

Buy BDH2-3-hydroxybutyrate dehydrogenase, type 2 Gene now

Add to cart