C12orf60-chromosome 12 open reading frame 60 Gene View larger

C12orf60-chromosome 12 open reading frame 60 Gene

PTXBC038836

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C12orf60-chromosome 12 open reading frame 60 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C12orf60-chromosome 12 open reading frame 60 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC038836
Product type: DNA & cDNA
Ncbi symbol: C12orf60
Origin species: Human
Product name: C12orf60-chromosome 12 open reading frame 60 Gene
Size: 2ug
Accessions: BC038836
Gene id: 144608
Gene description: chromosome 12 open reading frame 60
Synonyms: uncharacterized protein C12orf60; chromosome 12 open reading frame 60
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcttcagagtcagaaaaggataaagagagactgattcaagctgccaaaatgttcttctttcatgtacaagatcttgcttctgtcataaacacactgactgaattgtttagccgcagtatgaatactcaaatccttttgatggctgtgagaaacaatagttacattaaggatttttttgagcaaatgctcaaaatttttaaggagatgcaatctgtagtggatgcaagacatgacaaaattcaaaaggagtctttatgttccaaggttgcaatggccatgtgctctgtggttcagaagagtaccaatgtagaggagttgcatcagtcagctaaagaagtattcaaaagtgcccatacgccagtcatcatctctgtgctaaacagcagtaacatccttgggagtctggaatcttctctttcacacttgatgaaattccccatcatgaatcttcaattaagtgacttctatacagaagacaccaaagagcaatcagatgtcaccacatctgagagaaccagaagtcctccaggttcttccaaaaccactatgatagacaccttgaaaaaactgcaggatgtactaaaaactgaggattccaaaaatcccacaaagtcagcagcagatttgttggaacaaattgtcaaggctatgggaccaatcttagagatcctccaaaaagcgataaagactatggaaatgaatatttctgtgtttaagaaagccagtgacaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sulfotransferase family 4A, member 1
- chromosome 16 open reading frame 61
- chromosome 1 open reading frame 211
- chromosome 21 open reading frame 59

Buy C12orf60-chromosome 12 open reading frame 60 Gene now

Add to cart