C16orf61-chromosome 16 open reading frame 61 Gene View larger

C16orf61-chromosome 16 open reading frame 61 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf61-chromosome 16 open reading frame 61 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf61-chromosome 16 open reading frame 61 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032631
Product type: DNA & cDNA
Ncbi symbol: C16orf61
Origin species: Human
Product name: C16orf61-chromosome 16 open reading frame 61 Gene
Size: 2ug
Accessions: BC032631
Gene id: 56942
Gene description: chromosome 16 open reading frame 61
Synonyms: C16orf61; 2310061C15Rik; DC13; COX assembly mitochondrial protein 2 homolog; C-x(9)-C motif containing 2; C-X9-C motif containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcatcctgacttatctccacacttgcacactgaagaatgcaacgtcttgattaacttgcttaaggaatgtcacaaaaatcacaacattctgaaattttttggttattgtaatgatgttgatcgggagttgagaaaatgcctgaagaatgagtacgtagaaaacaggaccaagagcagggagcatggcattgcaatgcgaaagaaactttttaatcctccagaggaatccgaaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 211
- chromosome 21 open reading frame 59
- chromosome 6 open reading frame 218
- chromosome 18 open reading frame 56

Buy C16orf61-chromosome 16 open reading frame 61 Gene now

Add to cart