C1orf163-chromosome 1 open reading frame 163 Gene View larger

C1orf163-chromosome 1 open reading frame 163 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf163-chromosome 1 open reading frame 163 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf163-chromosome 1 open reading frame 163 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015313
Product type: DNA & cDNA
Ncbi symbol: C1orf163
Origin species: Human
Product name: C1orf163-chromosome 1 open reading frame 163 Gene
Size: 2ug
Accessions: BC015313
Gene id: 65260
Gene description: chromosome 1 open reading frame 163
Synonyms: hcp beta-lactamase-like protein C1orf163; C1orf163; RESA1; SELRC1; cytochrome c oxidase assembly factor 7; Sel1 repeat containing 1; beta-lactamase hcp-like protein; respiratory chain assembly 1; respiratory chain assembly factor 1; sel1 repeat-containing protein 1; cytochrome c oxidase assembly factor 7 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccggcatggtggacttccaggatgaggagcaggtcaagtcctttttggagaacatggaggtggagtgcaactaccactgctaccacgagaaggacccggacggttgctatcggctggtggactatttggaagggatccggaagaattttgatgaggctgccaaggtgttgaagtttaactgtgaagagaaccagcacagtgatagctgctacaaactgggggcctactatgtgactggaaaaggtggtctgacccaggacctgaaagctgccgccaggtgctttttgatggcgtgtgagaagcctggaaagaagtcaatagcagcatgtcacaacgttggcctcctggcacatgatggacaggttaatgaggatggccagcctgacttgggaaaggccagggactactacacaagggcctgtgatggtggctatacttccagttgcttcaacctcagtgccatgttcctgcagggtgccccaggctttcccaaggacatggacctggcatgtaaatactccatgaaagcctgtgacctgggtcatatctgggcctgtgccaatgccagtcgcatgtacaagctgggggatggtgttgataaggatgaggccaaggccgaggtgctaaaaaatcgagcccagcagctacacagagaacagcagaaaggtgtccaacccttaacatttgggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 3-hydroxybutyrate dehydrogenase, type 2
- chromosome 12 open reading frame 60
- sulfotransferase family 4A, member 1
- chromosome 16 open reading frame 61

Buy C1orf163-chromosome 1 open reading frame 163 Gene now

Add to cart