Login to display prices
Login to display prices
TM4SF4-transmembrane 4 L six family member 4 Gene View larger

TM4SF4-transmembrane 4 L six family member 4 Gene

PTXBC001386

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TM4SF4-transmembrane 4 L six family member 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TM4SF4-transmembrane 4 L six family member 4 Gene

Proteogenix catalog: PTXBC001386
Ncbi symbol: TM4SF4
Product name: TM4SF4-transmembrane 4 L six family member 4 Gene
Size: 2ug
Accessions: BC001386
Gene id: 7104
Gene description: transmembrane 4 L six family member 4
Synonyms: ILTMP; il-TMP; transmembrane 4 L6 family member 4; intestinal and liver (il) tetraspan membrane protein; intestine and liver tetraspan membrane protein; transmembrane 4 superfamily member 4; transmembrane 4 L six family member 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgcactgggggctgtgccagatgcctgggggggaccctcattccccttgctttttttggcttcctggctaacatcctgttattttttcctggaggaaaagtgatagatgacaacgaccacctttcccaagagatctggtttttcggaggaatattaggaagcggtgtcttgatgatcttccctgcgctggtgttcttgggcctgaagaacaatgactgctgtgggtgctgcggcaacgagggctgtgggaagcgatttgcgatgttcacctccacgatatttgctgtggttggattcttgggagctggatactcgtttatcatctcagccatttcaatcaacaagggtcctaaatgcctcatggccaatagtacatggggctaccccttccacgacggggattatctcaatgatgaggccttatggaacaagtgccgagagcctctcaatgtggttccctggaatctgaccctcttctccatcctgctggtcgtaggaggaatccagatggttctctgcgccatccaggtggtcaatggcctcctggggaccctctgtggggactgccagtgttgtggctgctgtgggggagatggacccgtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: