Login to display prices
Login to display prices
C12orf45-chromosome 12 open reading frame 45 Gene View larger

C12orf45-chromosome 12 open reading frame 45 Gene

PTXBC032326

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C12orf45-chromosome 12 open reading frame 45 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C12orf45-chromosome 12 open reading frame 45 Gene

Proteogenix catalog: PTXBC032326
Ncbi symbol: C12orf45
Product name: C12orf45-chromosome 12 open reading frame 45 Gene
Size: 2ug
Accessions: BC032326
Gene id: 121053
Gene description: chromosome 12 open reading frame 45
Synonyms: uncharacterized protein C12orf45; chromosome 12 open reading frame 45
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggtccatggcaagccccaggctagcccgagttgttcgtcgcccacccgggattcctcaggagtcccagtgtccaaggagctgctgacggcgggaagcgacggccgcggaggtatatgggacaggttgctcatcaactcccaacctaagtccagaaagacctccactcttcaaacagttcggatagagaggagtcccttattggaccaggtacagacatttctcccacagatggcacgggcaaatgaaaagctaagaaaagaaatggcagctgcaccacctggtcgtttcaatattgaaaacattgatgggcctcatagtaaagttatacaaatggatgtggctttgtttgagatgaatcagtcggattcaaaagaagtggacagttcagaagagagttcacaagacagttcagagaacagttcagaatcagaagacgaagatgacagcatcccatctgaagtcaccatagataacattaagcttcccaattctgaaggtggaaaaggcaagattgaagttttggacagtccagcaagtaaaaaaaaagaaatagtcaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: