C12orf45-chromosome 12 open reading frame 45 Gene View larger

C12orf45-chromosome 12 open reading frame 45 Gene

PTXBC032326

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C12orf45-chromosome 12 open reading frame 45 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C12orf45-chromosome 12 open reading frame 45 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032326
Product type: DNA & cDNA
Ncbi symbol: C12orf45
Origin species: Human
Product name: C12orf45-chromosome 12 open reading frame 45 Gene
Size: 2ug
Accessions: BC032326
Gene id: 121053
Gene description: chromosome 12 open reading frame 45
Synonyms: uncharacterized protein C12orf45; chromosome 12 open reading frame 45
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggtccatggcaagccccaggctagcccgagttgttcgtcgcccacccgggattcctcaggagtcccagtgtccaaggagctgctgacggcgggaagcgacggccgcggaggtatatgggacaggttgctcatcaactcccaacctaagtccagaaagacctccactcttcaaacagttcggatagagaggagtcccttattggaccaggtacagacatttctcccacagatggcacgggcaaatgaaaagctaagaaaagaaatggcagctgcaccacctggtcgtttcaatattgaaaacattgatgggcctcatagtaaagttatacaaatggatgtggctttgtttgagatgaatcagtcggattcaaaagaagtggacagttcagaagagagttcacaagacagttcagagaacagttcagaatcagaagacgaagatgacagcatcccatctgaagtcaccatagataacattaagcttcccaattctgaaggtggaaaaggcaagattgaagttttggacagtccagcaagtaaaaaaaaagaaatagtcaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 11 open reading frame 73
- transmembrane 4 L six family member 4
- chromosome 12 open reading frame 49
- chromosome 6 open reading frame 223

Buy C12orf45-chromosome 12 open reading frame 45 Gene now

Add to cart