Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RABL5-RAB, member RAS oncogene family-like 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RABL5-RAB, member RAS oncogene family-like 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009823 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RABL5 |
| Origin species: | Human |
| Product name: | RABL5-RAB, member RAS oncogene family-like 5 Gene |
| Size: | 2ug |
| Accessions: | BC009823 |
| Gene id: | 64792 |
| Gene description: | RAB, member RAS oncogene family-like 5 |
| Synonyms: | RABL5; intraflagellar transport protein 22 homolog; RAB, member RAS oncogene family-like 5; RAB, member of RAS oncogene family-like 5; intraflagellar transport 22 homolog; rab-like protein 5; intraflagellar transport 22 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgaaagccaagatcctcttcgtggggccttgcgagagtggaaaaactgttttggccaactttctgacagaatcttctgacatcactgaatacagcccaacccaaggagtgaggatcctagaatttgagaacccgcatgttaccagcaacaacaaaggcacgggctgtgaattcgagctatgggactgtggtggcgatgctaagtttgagtcctgctggccggccctgatgaaggatgctcatggagtggtgatcgtcttcaatgctgacatcccaagccaccggaaggaaatggagatgtggtattcctgctttgtccaacagccgtccttacaggacacacagtgtatgctaattgcacaccacaaaccaggctctggagatgataaaggaagcctgtctttgtcgccacccttgaacaagctgaagctggtgcactcaaacctggaagatgaccctgaggagatccggatggaattcataaagtatttaaaaagcataatcaactccatgtctgagagcagagacagggaggagatgtcaattatgacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 12 open reading frame 45 - chromosome 11 open reading frame 73 - transmembrane 4 L six family member 4 - chromosome 12 open reading frame 49 |