RABL5-RAB, member RAS oncogene family-like 5 Gene View larger

RABL5-RAB, member RAS oncogene family-like 5 Gene

PTXBC009823

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RABL5-RAB, member RAS oncogene family-like 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RABL5-RAB, member RAS oncogene family-like 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009823
Product type: DNA & cDNA
Ncbi symbol: RABL5
Origin species: Human
Product name: RABL5-RAB, member RAS oncogene family-like 5 Gene
Size: 2ug
Accessions: BC009823
Gene id: 64792
Gene description: RAB, member RAS oncogene family-like 5
Synonyms: RABL5; intraflagellar transport protein 22 homolog; RAB, member RAS oncogene family-like 5; RAB, member of RAS oncogene family-like 5; intraflagellar transport 22 homolog; rab-like protein 5; intraflagellar transport 22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgaaagccaagatcctcttcgtggggccttgcgagagtggaaaaactgttttggccaactttctgacagaatcttctgacatcactgaatacagcccaacccaaggagtgaggatcctagaatttgagaacccgcatgttaccagcaacaacaaaggcacgggctgtgaattcgagctatgggactgtggtggcgatgctaagtttgagtcctgctggccggccctgatgaaggatgctcatggagtggtgatcgtcttcaatgctgacatcccaagccaccggaaggaaatggagatgtggtattcctgctttgtccaacagccgtccttacaggacacacagtgtatgctaattgcacaccacaaaccaggctctggagatgataaaggaagcctgtctttgtcgccacccttgaacaagctgaagctggtgcactcaaacctggaagatgaccctgaggagatccggatggaattcataaagtatttaaaaagcataatcaactccatgtctgagagcagagacagggaggagatgtcaattatgacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 12 open reading frame 45
- chromosome 11 open reading frame 73
- transmembrane 4 L six family member 4
- chromosome 12 open reading frame 49

Buy RABL5-RAB, member RAS oncogene family-like 5 Gene now

Add to cart