TMEM44-transmembrane protein 44 Gene View larger

TMEM44-transmembrane protein 44 Gene

PTXBC034353

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM44-transmembrane protein 44 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM44-transmembrane protein 44 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034353
Product type: DNA & cDNA
Ncbi symbol: TMEM44
Origin species: Human
Product name: TMEM44-transmembrane protein 44 Gene
Size: 2ug
Accessions: BC034353
Gene id: 93109
Gene description: transmembrane protein 44
Synonyms: transmembrane protein 44
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagagcaagatgagacaggccttaggatttgccaaggaagccagagagagccctgacacccaagcccttttgacctgtgcagagaaagaggaagaaaaccaggagaatttggattgggtgcctctcaccacactgtcacactgcaagtcactgaggacaatgacagcaatcagtcgctacatggagctgaccatcgagcctgtgcagcaggcaggctgcagtgccaccaggctgccaggtgacgggcagacgagcgccggagatgcgtccctgcaggaccccccgtcgtaccctcccgttcaggtcatccgggcccgggtgtcttccggcagctcctctgaggtctcctccatcaactccgacctggagcagaagtattgggaggccctaaactcggagcagtgggaccctgaagatgtgaacctcgaaggcagcaaagaaaatgtggagctactgggatcccaggtgcaccaggactctgtgaggacagcacacctgagtgatgatgattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SCAN domain containing 1
- acireductone dioxygenase 1
- high-mobility group box 4
- transmembrane protein 99

Buy TMEM44-transmembrane protein 44 Gene now

Add to cart