SCAND1-SCAN domain containing 1 Gene View larger

SCAND1-SCAN domain containing 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCAND1-SCAN domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SCAND1-SCAN domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000785
Product type: DNA & cDNA
Ncbi symbol: SCAND1
Origin species: Human
Product name: SCAND1-SCAN domain containing 1 Gene
Size: 2ug
Accessions: BC000785
Gene id: 51282
Gene description: SCAN domain containing 1
Synonyms: RAZ1; SDP1; SCAN domain-containing protein 1; SCAN-related protein RAZ1; SCAN domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctacggagccgatcttggcggccactgggagtcccgcggcggtgccaccggagaaactggaaggagccggttcgagctcagcccctgagcgtaactgtgtgggctcctcgctgccagaggcctcaccgcctgcccctgagccttccagtcccaacgccgcggtccctgaagccatccctacgccccgagctgcggcctccgcggccctggagctgcctctcgggcccgcacccgtgagcgtagcgcctcaggccgaagctgaagcgcgctccacaccaggccccgccggctctagactcggtcccgagacgttccgccagcgtttccggcagttccgctaccaggatgcggcgggtccccgggaggctttccggcagctgcgggagctgtcccgccagtggctgcggcctgacatccgcaccaaggagcagatcgtggagatgctggtgcaagagcagctgctcgccatcctgcccgaggcggctcgggcccggcggatccgccgccgcacggatgtgcgcatcactggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acireductone dioxygenase 1
- high-mobility group box 4
- transmembrane protein 99
- high-mobility group box 2

Buy SCAND1-SCAN domain containing 1 Gene now

Add to cart