Login to display prices
Login to display prices
HMGB4-high-mobility group box 4 Gene View larger

HMGB4-high-mobility group box 4 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HMGB4-high-mobility group box 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HMGB4-high-mobility group box 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021180
Product type: DNA & cDNA
Ncbi symbol: HMGB4
Origin species: Human
Product name: HMGB4-high-mobility group box 4 Gene
Size: 2ug
Accessions: BC021180
Gene id: 127540
Gene description: high-mobility group box 4
Synonyms: dJ1007G16.5; high mobility group protein B4; HMG2 like; high mobility group box 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaaaagaaatccagctaaagcctaaggcaaatgtctcttcttacgttcactttttgctgaattacagaaacaaattcaaggagcagcagccaagtacctacgttggctttaaagagttctctagaaagtgttcggaaaaatggagatccatctcaaagcatgaaaaggccaaatatgaagccctggccaaactcgacaaagcccgataccaggaagaaatgatgaattatgttggcaagaggaagaaacggagaaagcgggatccccaggcacccagacggcctccatcatccttcctactcttctgccaagaccactatgctcagctgaagagggagaacccgaactggtcggtggtgcaggtggccaaggccacagggaagatgtggtcaacagcgacagacctggagaagcacccttatgagcaaagagtggctctcctgagagctaagtacttcgaggaacttgaactctaccgtaaacaatgtaatgccaggaagaagtaccgaatgtcagctagaaaccggtgcagagggaaaagagtcaggcagagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 99
- high-mobility group box 2
- programmed cell death 10
- histone cluster 1, H1c