TMEM99-transmembrane protein 99 Gene View larger

TMEM99-transmembrane protein 99 Gene

PTXBC015365

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM99-transmembrane protein 99 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM99-transmembrane protein 99 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015365
Product type: DNA & cDNA
Ncbi symbol: TMEM99
Origin species: Human
Product name: TMEM99-transmembrane protein 99 Gene
Size: 2ug
Accessions: BC015365
Gene id: 147184
Gene description: transmembrane protein 99
Synonyms: transmembrane protein 99
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttggcatcctcccactctgttgctccggctgtgtcccctcgctctgttgttccagctatgtcccctctgttgctccaactgcagctcattctgttagagttcctcattcagctggtcactgtggccagagggtgttggcctgctcccttcctcaagtattcttaaagccatggatttttgtggagcatttttcttcctggctctcccttgagttattttcctttcttcgctatcttgggactcttctttgtgcttgcggacatcggttgagagaaggacgacttcttccttgtctccttggtgttggctcgtggttgctcttcaacaactggactggaggctcttggttttctcttcatcttcaacaagtcagtctctctcaagggtctcacgttgcagcattcttaccagaggccattgggcctggagttccagttccagtgtctggagagtccacctcagctcagcaatctcatgccggttggcaattgtcagcagaagccgatgcctgcccatcagttctttactctgaggtgttagagtggaataaaaatataaatactt
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - high-mobility group box 2
- programmed cell death 10
- histone cluster 1, H1c
- transmembrane protein 98

Buy TMEM99-transmembrane protein 99 Gene now

Add to cart