Login to display prices
Login to display prices
TMEM99-transmembrane protein 99 Gene View larger

TMEM99-transmembrane protein 99 Gene

PTXBC015365

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM99-transmembrane protein 99 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM99-transmembrane protein 99 Gene

Proteogenix catalog: PTXBC015365
Ncbi symbol: TMEM99
Product name: TMEM99-transmembrane protein 99 Gene
Size: 2ug
Accessions: BC015365
Gene id: 147184
Gene description: transmembrane protein 99
Synonyms: transmembrane protein 99
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttggcatcctcccactctgttgctccggctgtgtcccctcgctctgttgttccagctatgtcccctctgttgctccaactgcagctcattctgttagagttcctcattcagctggtcactgtggccagagggtgttggcctgctcccttcctcaagtattcttaaagccatggatttttgtggagcatttttcttcctggctctcccttgagttattttcctttcttcgctatcttgggactcttctttgtgcttgcggacatcggttgagagaaggacgacttcttccttgtctccttggtgttggctcgtggttgctcttcaacaactggactggaggctcttggttttctcttcatcttcaacaagtcagtctctctcaagggtctcacgttgcagcattcttaccagaggccattgggcctggagttccagttccagtgtctggagagtccacctcagctcagcaatctcatgccggttggcaattgtcagcagaagccgatgcctgcccatcagttctttactctgaggtgttagagtggaataaaaatataaatactt
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: