HIST1H1C-histone cluster 1, H1c Gene View larger

HIST1H1C-histone cluster 1, H1c Gene

PTXBC002649

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIST1H1C-histone cluster 1, H1c Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIST1H1C-histone cluster 1, H1c Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002649
Product type: DNA & cDNA
Ncbi symbol: HIST1H1C
Origin species: Human
Product name: HIST1H1C-histone cluster 1, H1c Gene
Size: 2ug
Accessions: BC002649
Gene id: 3006
Gene description: histone cluster 1, H1c
Synonyms: H1.2; H1C; H1F2; H1s-1; histone H1.2; H1 histone family, member 2; histone 1, H1c; histone H1c; histone H1d; histone H1s-1; histone cluster 1, H1c; histone cluster 1 H1 family member c
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgagactgctcctgccgctcccgctgccgcgcctcctgcggagaaggcccctgtaaagaagaaggcggccaaaaaggctgggggtacgcctcgtaaggcgtctggtcccccggtgtcagagctcatcaccaaggctgtggccgcctctaaagagcgtagcggagtttctctggctgctctgaaaaaagcgttggctgccgccggctatgatgtggagaaaaacaacagccgtatcaaacttggtctcaagagcctggtgagcaagggcactctggtgcaaacgaaaggcaccggtgcttctggctcctttaaactcaacaagaaggcagcctccggggaagccaagcccaaggttaaaaaggcgggcggaaccaaacctaagaagccagttggggcagccaagaagcccaagaaggcggctggcggcgcaactccgaagaagagcgctaagaaaacaccgaagaaagcgaagaagccggccgcggccactgtaaccaagaaagtggctaagagcccaaagaaggccaaggttgcgaagcccaagaaagctgccaaaagtgctgctaaggctgtgaagcccaaggccgctaagcccaaggttgtcaagcctaagaaggcggcgcccaagaagaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 98
- sodium channel modifier 1
- thymidine kinase 1, soluble
- Ras-related GTP binding D

Buy HIST1H1C-histone cluster 1, H1c Gene now

Add to cart