Login to display prices
Login to display prices
ADI1-acireductone dioxygenase 1 Gene View larger

ADI1-acireductone dioxygenase 1 Gene

PTXBC001467

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ADI1-acireductone dioxygenase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ADI1-acireductone dioxygenase 1 Gene

Proteogenix catalog: PTXBC001467
Ncbi symbol: ADI1
Product name: ADI1-acireductone dioxygenase 1 Gene
Size: 2ug
Accessions: BC001467
Gene id: 55256
Gene description: acireductone dioxygenase 1
Synonyms: APL1; ARD; Fe-ARD; HMFT1638; MTCBP1; Ni-ARD; SIPL; mtnD; 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase; MT1-MMP cytoplasmic tail-binding protein-1; acireductone dioxygenase (Fe(2+)-requiring); acireductone dioxygenase (Ni(2+)-requiring); membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1; submergence induced protein 2; submergence-induced protein-like factor; acireductone dioxygenase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcaggcctggtatatggacgacgccccgggcgacccgcggcaaccccaccgccccgaccccggccgcccagtgggcctggagcagctgcggcggctcggggtgctctactggaagctggatgctgacaaatatgagaatgatccagaattagaaaagatccgaagagagaggaactactcctggatggacatcataaccatatgcaaagataaactaccaaattatgaagaaaagattaagatgttctacgaggagcatttgcacttggacgatgagatccgctacatcctggatggcagtgggtacttcgatgtgagggacaaggaggaccagtggatccggatcttcatggagaagggagacatggtgacgctccccgcggggatctatcaccgcttcacggtggacgagaagaactacacgaaggccatgcggctgtttgtgggagaaccggtgtggacagcgtacaaccggcccgctgaccattttgaagcccgcgggcagtacgtgaaatttctggcacagaccgcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: