Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ADI1-acireductone dioxygenase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ADI1-acireductone dioxygenase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001467 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ADI1 |
| Origin species: | Human |
| Product name: | ADI1-acireductone dioxygenase 1 Gene |
| Size: | 2ug |
| Accessions: | BC001467 |
| Gene id: | 55256 |
| Gene description: | acireductone dioxygenase 1 |
| Synonyms: | APL1; ARD; Fe-ARD; HMFT1638; MTCBP1; Ni-ARD; SIPL; mtnD; 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase; MT1-MMP cytoplasmic tail-binding protein-1; acireductone dioxygenase (Fe(2+)-requiring); acireductone dioxygenase (Ni(2+)-requiring); membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1; submergence induced protein 2; submergence-induced protein-like factor; acireductone dioxygenase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgcaggcctggtatatggacgacgccccgggcgacccgcggcaaccccaccgccccgaccccggccgcccagtgggcctggagcagctgcggcggctcggggtgctctactggaagctggatgctgacaaatatgagaatgatccagaattagaaaagatccgaagagagaggaactactcctggatggacatcataaccatatgcaaagataaactaccaaattatgaagaaaagattaagatgttctacgaggagcatttgcacttggacgatgagatccgctacatcctggatggcagtgggtacttcgatgtgagggacaaggaggaccagtggatccggatcttcatggagaagggagacatggtgacgctccccgcggggatctatcaccgcttcacggtggacgagaagaactacacgaaggccatgcggctgtttgtgggagaaccggtgtggacagcgtacaaccggcccgctgaccattttgaagcccgcgggcagtacgtgaaatttctggcacagaccgcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - high-mobility group box 4 - transmembrane protein 99 - high-mobility group box 2 - programmed cell death 10 |