Login to display prices
Login to display prices
TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene View larger

TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene

PTXBC022030

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC022030
Ncbi symbol: TSEN15
Product name: TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC022030
Gene id: 116461
Gene description: tRNA splicing endonuclease 15 homolog (S. cerevisiae)
Synonyms: TSEN15 tRNA splicing endonuclease subunit; C1orf19; PCH2F; sen15; tRNA-splicing endonuclease subunit Sen15; tRNA splicing endonuclease 15 homolog; tRNA-intron endonuclease Sen15; tRNA splicing endonuclease subunit 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagcgcggcgattccgagccgacccccggctgcagcggcctgggtccgggcggtgttcgcggctttggcgacggcggtggagctccttcgtgggcccctgaggacgcctggatgggcactcaccctaagtatctagaaatgatggaattagatataggagatgccacccaagtttatgtagcgttcttggtttacctggacctcatggaaagcaaaagctggcatgaagtaaactgtgtaggattaccagaactccagctcatctgccttgttggtactgagatagaaggggaggggttacagactgtggtgcctacccccatcactgcttccctcagccataacaggataagggagatcttgaaggcatctcgaaagttgcaaggtgatccagatttgccgatgtcttttactttggccatagtggagtctgattctacaatagtctattataaacttactgatggatttatgctgccagaccctcagaatatttctcttagaagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: