TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene View larger

TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene

PTXBC022030

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022030
Product type: DNA & cDNA
Ncbi symbol: TSEN15
Origin species: Human
Product name: TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC022030
Gene id: 116461
Gene description: tRNA splicing endonuclease 15 homolog (S. cerevisiae)
Synonyms: TSEN15 tRNA splicing endonuclease subunit; C1orf19; PCH2F; sen15; tRNA-splicing endonuclease subunit Sen15; tRNA splicing endonuclease 15 homolog; tRNA-intron endonuclease Sen15; tRNA splicing endonuclease subunit 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagcgcggcgattccgagccgacccccggctgcagcggcctgggtccgggcggtgttcgcggctttggcgacggcggtggagctccttcgtgggcccctgaggacgcctggatgggcactcaccctaagtatctagaaatgatggaattagatataggagatgccacccaagtttatgtagcgttcttggtttacctggacctcatggaaagcaaaagctggcatgaagtaaactgtgtaggattaccagaactccagctcatctgccttgttggtactgagatagaaggggaggggttacagactgtggtgcctacccccatcactgcttccctcagccataacaggataagggagatcttgaaggcatctcgaaagttgcaaggtgatccagatttgccgatgtcttttactttggccatagtggagtctgattctacaatagtctattataaacttactgatggatttatgctgccagaccctcagaatatttctcttagaagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
- Fc fragment of IgG, low affinity IIa, receptor (CD32)
- membrane-bound transcription factor peptidase, site 2
- GATA binding protein 1 (globin transcription factor 1)

Buy TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene now

Add to cart