Cart 3 Product Products 839,17 € (empty)
-
1 x TMEM69-tra...113,40 € -
-
No products
To be determined Shipping
839,17 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 839,17 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 839,17 €
Data sheet of DAZAP2-DAZ associated protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DAZAP2-DAZ associated protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002334 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DAZAP2 |
| Origin species: | Human |
| Product name: | DAZAP2-DAZ associated protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC002334 |
| Gene id: | 9802 |
| Gene description: | DAZ associated protein 2 |
| Synonyms: | PRTB; DAZ-associated protein 2; deleted in azoospermia associated protein 2; proline-rich transcript in brain; proline-rich transcript, brain-expressed protein; DAZ associated protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacagcaaaggtcaatatccaacacagccaacctaccctgtgcagcctcctgggaatccagtataccctcagaccttgcatcttcctcaggctccaccctataccgatgctccacctgcctactcagagctctatcgtccgagctttgtgcacccaggggctgccacagtccccaccatgtcagccgcatttcctggagcctctctgtatcttcccatggcccagtctgtggctgttgggcctttaggttccacaatccccatggcttattatccagtcggtcccatctatccacctggctccacagtgctggtggaaggagggtatgatgcaggtgccagatttggagctggggctactgctggcaacattcctcctccacctcctggatgccctcccaatgctgctcagcttgcagtcatgcagggagccaacgtcctcgtaactcagcggaaggggaacttcttcatgggtggttcagatggtggctacaccatctggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 44 - SCAN domain containing 1 - acireductone dioxygenase 1 - high-mobility group box 4 |