RAG1AP1-recombination activating gene 1 activating protein 1 Gene View larger

RAG1AP1-recombination activating gene 1 activating protein 1 Gene

PTXBC009621

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAG1AP1-recombination activating gene 1 activating protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAG1AP1-recombination activating gene 1 activating protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009621
Product type: DNA & cDNA
Ncbi symbol: RAG1AP1
Origin species: Human
Product name: RAG1AP1-recombination activating gene 1 activating protein 1 Gene
Size: 2ug
Accessions: BC009621
Gene id: 55974
Gene description: recombination activating gene 1 activating protein 1
Synonyms: RAG1AP1; HsSWEET1; SCP; SWEET1; slv; sugar transporter SWEET1; RAG1-activating protein 1; RP11-540D14.5; RZPDo834D038D; recombination activating gene 1 activating protein 1; solute carrier family 50 (sugar efflux transporter), member 1; solute carrier family 50 (sugar transporter), member 1; stromal cell protein; solute carrier family 50 member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggcgggcggctttctggactcgctcatttacggagcatgcgtggtcttcacccttggcatgttctccgccggcctctcggacctcaggcacatgcgaatgacccggagtgtggacaacgtccagttcctgccctttctcaccacggaagtcaacaacctgggctggctgagttatggggctttgaagggagacgggatcctcatcgtcgtcaacacagtgggtgctgcgcttcagaccctgtatatcttggcatatctgcattactgccctcggaaggctaaggtgattcaaactaaatcaacccaatgtctctcctacccactcaccattgctacccttctcacctctgcctcctggtgcctctatgggtttcgactcagagatccctatatcatggtgtccaactttccaggaatcgtcaccagctttatccgcttctggcttttctggaagtacccccaggagcaagacaggaactactggctcctgcaaacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tRNA splicing endonuclease 15 homolog (S. cerevisiae)
- NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
- Fc fragment of IgG, low affinity IIa, receptor (CD32)
- membrane-bound transcription factor peptidase, site 2

Buy RAG1AP1-recombination activating gene 1 activating protein 1 Gene now

Add to cart