HIST1H2BN-histone cluster 1, H2bn Gene View larger

HIST1H2BN-histone cluster 1, H2bn Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIST1H2BN-histone cluster 1, H2bn Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HIST1H2BN-histone cluster 1, H2bn Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011372
Product type: DNA & cDNA
Ncbi symbol: HIST1H2BN
Origin species: Human
Product name: HIST1H2BN-histone cluster 1, H2bn Gene
Size: 2ug
Accessions: BC011372
Gene id: 8341
Gene description: histone cluster 1, H2bn
Synonyms: H2B/d; H2BFD; histone H2B type 1-N; H2B histone family, member D; histone 1, H2bn; histone H2B.d; histone cluster 1, H2bn; histone cluster 1 H2B family member n
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccgagccctcaaagtccgctcctgccccgaagaaaggctccaagaaggcagtgacaaaggcccagaagaaggacggcaagaagcgcaagcgcagccgcaaggagagctactccgtgtacgtgtacaaggtgctgaagcaggtccaccccgacaccggtatctcgtccaaggccatgggcatcatgaactccttcgtcaatgacatcttcgagcgcatcgccggcgaggcttcccgcctggcgcattacaacaagcgctcgaccatcacctccagggagatccagacggccgtgcgcctgctgctgccaggggagctggccaagcacgcggtgtcggagggcaccaaggccgtcaccaagtacaccagttccaagaagagaaaaagaagattcacagagagcattaagaaggcccatggattcagaaagctcaagatttggctaaaattaagagtcagcaaccaatctccagatgacatttatattgcaagagattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methyltransferase like 10
- fibroblast growth factor 19
- transmembrane protein 147
- neuronal growth regulator 1

Buy HIST1H2BN-histone cluster 1, H2bn Gene now

Add to cart