Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST1H2BN-histone cluster 1, H2bn Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST1H2BN-histone cluster 1, H2bn Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011372 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST1H2BN |
| Origin species: | Human |
| Product name: | HIST1H2BN-histone cluster 1, H2bn Gene |
| Size: | 2ug |
| Accessions: | BC011372 |
| Gene id: | 8341 |
| Gene description: | histone cluster 1, H2bn |
| Synonyms: | H2B/d; H2BFD; histone H2B type 1-N; H2B histone family, member D; histone 1, H2bn; histone H2B.d; histone cluster 1, H2bn; histone cluster 1 H2B family member n |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccgagccctcaaagtccgctcctgccccgaagaaaggctccaagaaggcagtgacaaaggcccagaagaaggacggcaagaagcgcaagcgcagccgcaaggagagctactccgtgtacgtgtacaaggtgctgaagcaggtccaccccgacaccggtatctcgtccaaggccatgggcatcatgaactccttcgtcaatgacatcttcgagcgcatcgccggcgaggcttcccgcctggcgcattacaacaagcgctcgaccatcacctccagggagatccagacggccgtgcgcctgctgctgccaggggagctggccaagcacgcggtgtcggagggcaccaaggccgtcaccaagtacaccagttccaagaagagaaaaagaagattcacagagagcattaagaaggcccatggattcagaaagctcaagatttggctaaaattaagagtcagcaaccaatctccagatgacatttatattgcaagagattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - methyltransferase like 10 - fibroblast growth factor 19 - transmembrane protein 147 - neuronal growth regulator 1 |