CDKN1A-cyclin-dependent kinase inhibitor 1A (p21, Cip1) Gene View larger

CDKN1A-cyclin-dependent kinase inhibitor 1A (p21, Cip1) Gene

PTXBC000275

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDKN1A-cyclin-dependent kinase inhibitor 1A (p21, Cip1) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDKN1A-cyclin-dependent kinase inhibitor 1A (p21, Cip1) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000275
Product type: DNA & cDNA
Ncbi symbol: CDKN1A
Origin species: Human
Product name: CDKN1A-cyclin-dependent kinase inhibitor 1A (p21, Cip1) Gene
Size: 2ug
Accessions: BC000275
Gene id: 1026
Gene description: cyclin-dependent kinase inhibitor 1A (p21, Cip1)
Synonyms: CAP20; CDKN1; CIP1; MDA-6; SDI1; WAF1; p21CIP1; cyclin-dependent kinase inhibitor 1; CDK-interacting protein 1; CDK-interaction protein 1; DNA synthesis inhibitor; cyclin-dependent kinase inhibitor 1A (p21, Cip1); melanoma differentiation associated protein 6; wild-type p53-activated fragment 1; cyclin dependent kinase inhibitor 1A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagaaccggctggggatgtccgtcagaacccatgcggcagcaaggcctgccgccgcctcttcggcccagtggacagcgagcagctgagccgcgactgtgatgcgctaatggcgggctgcatccaggaggcccgtgagcgatggaacttcgactttgtcaccgagacaccactggagggtgacttcgcctgggagcgtgtgcggggccttggcctgcccaagctctaccttcccacggggccccggcgaggccgggatgagttgggaggaggcaggcggcctggcacctcacctgctctgctgcaggggacagcagaggaagaccatgtggacctgtcactgtcttgtacccttgtgcctcgctcaggggagcaggctgaagggtccccaggtggacctggagactctcagggtcgaaaacggcggcagaccagcatgacagatttctaccactccaaacgccggctgatcttctccaagaggaagccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FUS interacting protein (serine/arginine-rich) 1
- cyclin-dependent kinase inhibitor 1B (p27, Kip1)
- heterogeneous nuclear ribonucleoprotein A2/B1
- C1q and tumor necrosis factor related protein 1

Buy CDKN1A-cyclin-dependent kinase inhibitor 1A (p21, Cip1) Gene now

Add to cart