Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CDKN1A-cyclin-dependent kinase inhibitor 1A (p21, Cip1) Gene
PTXBC000275
New product
Data sheet of CDKN1A-cyclin-dependent kinase inhibitor 1A (p21, Cip1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDKN1A-cyclin-dependent kinase inhibitor 1A (p21, Cip1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000275 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDKN1A |
| Origin species: | Human |
| Product name: | CDKN1A-cyclin-dependent kinase inhibitor 1A (p21, Cip1) Gene |
| Size: | 2ug |
| Accessions: | BC000275 |
| Gene id: | 1026 |
| Gene description: | cyclin-dependent kinase inhibitor 1A (p21, Cip1) |
| Synonyms: | CAP20; CDKN1; CIP1; MDA-6; SDI1; WAF1; p21CIP1; cyclin-dependent kinase inhibitor 1; CDK-interacting protein 1; CDK-interaction protein 1; DNA synthesis inhibitor; cyclin-dependent kinase inhibitor 1A (p21, Cip1); melanoma differentiation associated protein 6; wild-type p53-activated fragment 1; cyclin dependent kinase inhibitor 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcagaaccggctggggatgtccgtcagaacccatgcggcagcaaggcctgccgccgcctcttcggcccagtggacagcgagcagctgagccgcgactgtgatgcgctaatggcgggctgcatccaggaggcccgtgagcgatggaacttcgactttgtcaccgagacaccactggagggtgacttcgcctgggagcgtgtgcggggccttggcctgcccaagctctaccttcccacggggccccggcgaggccgggatgagttgggaggaggcaggcggcctggcacctcacctgctctgctgcaggggacagcagaggaagaccatgtggacctgtcactgtcttgtacccttgtgcctcgctcaggggagcaggctgaagggtccccaggtggacctggagactctcagggtcgaaaacggcggcagaccagcatgacagatttctaccactccaaacgccggctgatcttctccaagaggaagccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - FUS interacting protein (serine/arginine-rich) 1 - cyclin-dependent kinase inhibitor 1B (p27, Kip1) - heterogeneous nuclear ribonucleoprotein A2/B1 - C1q and tumor necrosis factor related protein 1 |