Login to display prices
Login to display prices
CEP290-centrosomal protein 290kDa Gene View larger

CEP290-centrosomal protein 290kDa Gene

PTXBC008641

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CEP290-centrosomal protein 290kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CEP290-centrosomal protein 290kDa Gene

Proteogenix catalog: PTXBC008641
Ncbi symbol: CEP290
Product name: CEP290-centrosomal protein 290kDa Gene
Size: 2ug
Accessions: BC008641
Gene id: 80184
Gene description: centrosomal protein 290kDa
Synonyms: 3H11Ag; BBS14; CT87; JBTS5; LCA10; MKS4; NPHP6; POC3; SLSN6; rd16; centrosomal protein of 290 kDa; Bardet-Biedl syndrome 14 protein; CTCL tumor antigen se2-2; Meckel syndrome, type 4; POC3 centriolar protein homolog; cancer/testis antigen 87; centrosomal protein 290kDa; monoclonal antibody 3H11 antigen; nephrocytsin-6; prostate cancer antigen T21; tumor antigen se2-2; centrosomal protein 290
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccattttcaagattgcagctctccaaaaagttgtagataatagtgtttctttgtctgaactagaactggctaataaacagtacaatgaactgactgctaagtacagggacatcttgcaaaaagataatatgcttgttcaaagaacaagtaacttggaacacctggagtgtgaaaacatctccttaaaagaacaagtggagtctataaataaagaactggagattaccaaggaaaaacttcacactattgaacaagcctgggaacaggaaactaaattaggtaatgaatctagcatggataaggcaaagaaatcaataaccaacagtgacattgtttccatttcaaaaaaaataactatgctggaaatgaaggaattaaatgaaaggcagcgggctgaacattgtcaaaaaatgtatgaacacttacggacttcgttaaagcaaatggaggaacgtaattttgaattggaaaccaaatttgctgaggtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: