Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CEP290-centrosomal protein 290kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CEP290-centrosomal protein 290kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008641 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CEP290 |
| Origin species: | Human |
| Product name: | CEP290-centrosomal protein 290kDa Gene |
| Size: | 2ug |
| Accessions: | BC008641 |
| Gene id: | 80184 |
| Gene description: | centrosomal protein 290kDa |
| Synonyms: | 3H11Ag; BBS14; CT87; JBTS5; LCA10; MKS4; NPHP6; POC3; SLSN6; rd16; centrosomal protein of 290 kDa; Bardet-Biedl syndrome 14 protein; CTCL tumor antigen se2-2; Meckel syndrome, type 4; POC3 centriolar protein homolog; cancer/testis antigen 87; centrosomal protein 290kDa; monoclonal antibody 3H11 antigen; nephrocytsin-6; prostate cancer antigen T21; tumor antigen se2-2; centrosomal protein 290 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccattttcaagattgcagctctccaaaaagttgtagataatagtgtttctttgtctgaactagaactggctaataaacagtacaatgaactgactgctaagtacagggacatcttgcaaaaagataatatgcttgttcaaagaacaagtaacttggaacacctggagtgtgaaaacatctccttaaaagaacaagtggagtctataaataaagaactggagattaccaaggaaaaacttcacactattgaacaagcctgggaacaggaaactaaattaggtaatgaatctagcatggataaggcaaagaaatcaataaccaacagtgacattgtttccatttcaaaaaaaataactatgctggaaatgaaggaattaaatgaaaggcagcgggctgaacattgtcaaaaaatgtatgaacacttacggacttcgttaaagcaaatggaggaacgtaattttgaattggaaaccaaatttgctgaggtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - histone cluster 1, H2bn - methyltransferase like 10 - fibroblast growth factor 19 - transmembrane protein 147 |