C19orf41-chromosome 19 open reading frame 41 Gene View larger

C19orf41-chromosome 19 open reading frame 41 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf41-chromosome 19 open reading frame 41 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf41-chromosome 19 open reading frame 41 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029535
Product type: DNA & cDNA
Ncbi symbol: C19orf41
Origin species: Human
Product name: C19orf41-chromosome 19 open reading frame 41 Gene
Size: 2ug
Accessions: BC029535
Gene id: 126123
Gene description: chromosome 19 open reading frame 41
Synonyms: C19orf41; PLAL6978; PRO21961; SCRL; izumo sperm-egg fusion protein 2; IZUMO family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcatggaggggcctttcttccgggactacgcgctgaacgtgtttgtggggaaagtggagacaaatcaactggaccttgtggcgtcctttgtcaagaaccaaacgcagcacttaatgggtaactctctgaaagatgagcctctgctggaagagctggtgaccctcagggcgaatgtgatcaaggaattcaagaaagttttaatttcatatgaattaaaagcctgcaaccccaaactttgccgcttgctaaaagaagaggtgttggactgtttacattgccagaggatcactcccaagtgtatccacaaaaagtactgctttgtcgaccggcaaccccgcgtggccctgcagtaccagatggacagcaaatacccgaggaaccaggcgctgttgggcatcctcatttctgtgtctctggctgtctttgtcttcgtggtcatcgtggtctcggcttgtacatacagacaaaaccgaaaactcctgctgcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 19 open reading frame 43
- RAB, member RAS oncogene family-like 5
- chromosome 12 open reading frame 45
- chromosome 11 open reading frame 73

Buy C19orf41-chromosome 19 open reading frame 41 Gene now

Add to cart