Login to display prices
Login to display prices
C19orf41-chromosome 19 open reading frame 41 Gene View larger

C19orf41-chromosome 19 open reading frame 41 Gene

PTXBC029535

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf41-chromosome 19 open reading frame 41 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf41-chromosome 19 open reading frame 41 Gene

Proteogenix catalog: PTXBC029535
Ncbi symbol: C19orf41
Product name: C19orf41-chromosome 19 open reading frame 41 Gene
Size: 2ug
Accessions: BC029535
Gene id: 126123
Gene description: chromosome 19 open reading frame 41
Synonyms: C19orf41; PLAL6978; PRO21961; SCRL; izumo sperm-egg fusion protein 2; IZUMO family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcatggaggggcctttcttccgggactacgcgctgaacgtgtttgtggggaaagtggagacaaatcaactggaccttgtggcgtcctttgtcaagaaccaaacgcagcacttaatgggtaactctctgaaagatgagcctctgctggaagagctggtgaccctcagggcgaatgtgatcaaggaattcaagaaagttttaatttcatatgaattaaaagcctgcaaccccaaactttgccgcttgctaaaagaagaggtgttggactgtttacattgccagaggatcactcccaagtgtatccacaaaaagtactgctttgtcgaccggcaaccccgcgtggccctgcagtaccagatggacagcaaatacccgaggaaccaggcgctgttgggcatcctcatttctgtgtctctggctgtctttgtcttcgtggtcatcgtggtctcggcttgtacatacagacaaaaccgaaaactcctgctgcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: