TMEM159-transmembrane protein 159 Gene View larger

TMEM159-transmembrane protein 159 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM159-transmembrane protein 159 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM159-transmembrane protein 159 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015812
Product type: DNA & cDNA
Ncbi symbol: TMEM159
Origin species: Human
Product name: TMEM159-transmembrane protein 159 Gene
Size: 2ug
Accessions: BC015812
Gene id: 57146
Gene description: transmembrane protein 159
Synonyms: transmembrane protein 159
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaaagaggagccccagagtatctcaagggacttgcaggaactgcagaagaagctgtctctgctgatagactccttccagaataactcaaaggtggtggcctttatgaagtctccagtgggtcagtacttggacagccatccgtttctggccttcaccttgctggtgttcattgtcatgtcggccgttcctgttggattcttcctgctcatcgtggtgcttaccaccctggctgctctgctgggggtcataatattggaaggattggtcatctctgtgggtggcttctcactgctctgcatcctctgtggtttgggcttcgtatcactcgccatgtcggggatgatgatagcatcttatgtagtggtctccagcctcatcagctgctggttttctcccaggccactgacacagcaaaacaccagttgtgactttctgccagccatgaagtctgcagacttcgaggggctttaccaggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - centrosomal protein 290kDa
- histone cluster 1, H2bn
- methyltransferase like 10
- fibroblast growth factor 19

Buy TMEM159-transmembrane protein 159 Gene now

Add to cart