Login to display prices
Login to display prices
TMEM159-transmembrane protein 159 Gene View larger

TMEM159-transmembrane protein 159 Gene

PTXBC015812

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM159-transmembrane protein 159 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM159-transmembrane protein 159 Gene

Proteogenix catalog: PTXBC015812
Ncbi symbol: TMEM159
Product name: TMEM159-transmembrane protein 159 Gene
Size: 2ug
Accessions: BC015812
Gene id: 57146
Gene description: transmembrane protein 159
Synonyms: transmembrane protein 159
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaaagaggagccccagagtatctcaagggacttgcaggaactgcagaagaagctgtctctgctgatagactccttccagaataactcaaaggtggtggcctttatgaagtctccagtgggtcagtacttggacagccatccgtttctggccttcaccttgctggtgttcattgtcatgtcggccgttcctgttggattcttcctgctcatcgtggtgcttaccaccctggctgctctgctgggggtcataatattggaaggattggtcatctctgtgggtggcttctcactgctctgcatcctctgtggtttgggcttcgtatcactcgccatgtcggggatgatgatagcatcttatgtagtggtctccagcctcatcagctgctggttttctcccaggccactgacacagcaaaacaccagttgtgactttctgccagccatgaagtctgcagacttcgaggggctttaccaggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: