No products
Prices are tax excluded
PTXBC000465
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000465 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GADD45G |
| Origin species: | Human |
| Product name: | GADD45G-growth arrest and DNA-damage-inducible, gamma Gene |
| Size: | 2ug |
| Accessions: | BC000465 |
| Gene id: | 10912 |
| Gene description: | growth arrest and DNA-damage-inducible, gamma |
| Synonyms: | CR6; DDIT2; GADD45gamma; GRP17; growth arrest and DNA damage-inducible protein GADD45 gamma; DDIT-2; DNA damage-inducible transcript 2 protein; GADD45-gamma; cytokine-responsive protein CR6; gadd-related protein, 17 kD; growth arrest and DNA damage inducible gamma |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactctggaagaagtccgcggccaggacacagttccggaaagcacagccaggatgcagggtgccgggaaagcgctgcatgagttgctgctgtcggcgcagcgtcagggctgcctcactgccggcgtctacgagtcagccaaagtcttgaacgtggaccccgacaatgtgaccttctgtgtgctggctgcgggtgaggaggacgagggcgacatcgcgctgcagatccattttacgctgatccaggctttctgctgcgagaacgacatcgacatagtgcgcgtgggcgatgtgcagcggctggcggctatcgtgggcgccggcgaggaggcgggtgcgccgggcgacctgcactgcatcctcatttcgaaccccaacgaggacgcctggaaggatcccgccttggagaagctcagcctgttttgcgaggagagccgcagcgttaacgactgggtgcccagcatcaccctccccgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - ADP-ribosylation factor-like 2 binding protein - family with sequence similarity 158, member A - monocyte to macrophage differentiation-associated - leucine-rich repeats and IQ motif containing 1 |