PTXBC000465
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix | 
| Product type | DNA & cDNA | 
| Origin species | Human | 
| Brand: | ProteoGenix | 
| Proteogenix catalog: | PTXBC000465 | 
| Product type: | DNA & cDNA | 
| Ncbi symbol: | GADD45G | 
| Origin species: | Human | 
| Product name: | GADD45G-growth arrest and DNA-damage-inducible, gamma Gene | 
| Size: | 2ug | 
| Accessions: | BC000465 | 
| Gene id: | 10912 | 
| Gene description: | growth arrest and DNA-damage-inducible, gamma | 
| Synonyms: | CR6; DDIT2; GADD45gamma; GRP17; growth arrest and DNA damage-inducible protein GADD45 gamma; DDIT-2; DNA damage-inducible transcript 2 protein; GADD45-gamma; cytokine-responsive protein CR6; gadd-related protein, 17 kD; growth arrest and DNA damage inducible gamma | 
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG | 
| Orf sequence: | atgactctggaagaagtccgcggccaggacacagttccggaaagcacagccaggatgcagggtgccgggaaagcgctgcatgagttgctgctgtcggcgcagcgtcagggctgcctcactgccggcgtctacgagtcagccaaagtcttgaacgtggaccccgacaatgtgaccttctgtgtgctggctgcgggtgaggaggacgagggcgacatcgcgctgcagatccattttacgctgatccaggctttctgctgcgagaacgacatcgacatagtgcgcgtgggcgatgtgcagcggctggcggctatcgtgggcgccggcgaggaggcgggtgcgccgggcgacctgcactgcatcctcatttcgaaccccaacgaggacgcctggaaggatcccgccttggagaagctcagcctgttttgcgaggagagccgcagcgttaacgactgggtgcccagcatcaccctccccgagtga | 
| Vector: | pDONR223 | 
| Delivery lead time in business days in europe: | 10-12 days | 
| Storage: | -20â | 
| Delivery condition: | Blue Ice | 
| Related products: | - ADP-ribosylation factor-like 2 binding protein - family with sequence similarity 158, member A - monocyte to macrophage differentiation-associated - leucine-rich repeats and IQ motif containing 1 |